EMAIL THIS PAGE TO A FRIEND

DDRGK1

DDRGK domain containing 1

98 Gene Product Result for
Synonyms: C20orf116 UFBP1 dJ1187M17.3
UniProtKB ID: Q96HY6, A6NIU5, C9JSZ5, Q9BW47
Gene ID:
Mouse(77006) DDRGK domain containing 1
Rat(296162) DDRGK domain containing 1
Zebrafish(393263) DDRGK domain containing 1
domestic cat(101094750) DDRGK domain containing 1
cow(511144) DDRGK domain containing 1
dog(477173) DDRGK domain containing 1
chicken(422941) DDRGK domain containing 1
domestic guinea pig(101787082) DDRGK domain containing 1
naked mole-rat(101721310) DDRGK domain containing 1
sheep(101122540) DDRGK domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023935 Rosetta Predictions human pricing
NM_001106512 Rosetta Predictions rat pricing
NM_029832 Rosetta Predictions mouse pricing
XM_485067 Rosetta Predictions mouse pricing
XM_901930 Rosetta Predictions mouse pricing
XM_901933 Rosetta Predictions mouse pricing
XM_901934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127488 predicted 849
2 SASI_Hs01_00127489 predicted 999
3 SASI_Hs01_00127490 predicted 782
4 SASI_Hs01_00127491 predicted 998
5 SASI_Hs01_00127492 predicted 969
6 SASI_Hs01_00127493 predicted 230
7 SASI_Hs01_00127495 predicted 206
8 SASI_Hs01_00127496 predicted 986
9 SASI_Hs01_00127497 predicted 894
10 SASI_Hs02_00356402 predicted 291
11 SASI_Hs01_00127494 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219698 predicted 405
2 SASI_Rn02_00219699 predicted 1192
3 SASI_Rn02_00219700 predicted 524
4 SASI_Rn02_00219701 predicted 586
5 SASI_Rn02_00219702 predicted 467
6 SASI_Rn02_00219703 predicted 1193
7 SASI_Rn02_00219704 predicted 587
8 SASI_Rn02_00219705 predicted 471
9 SASI_Rn02_00219706 predicted 1296
10 SASI_Rn02_00219707 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336004 predicted 848
2 SASI_Mm02_00336005 predicted 307
3 SASI_Mm02_00336006 predicted 843
4 SASI_Mm02_00336007 predicted 275
5 SASI_Mm02_00336008 predicted 298
6 SASI_Mm02_00336009 predicted 276
7 SASI_Mm02_00336010 predicted 282
8 SASI_Mm02_00336011 predicted 211
9 SASI_Mm02_00336012 predicted 316
10 SASI_Mm02_00336013 predicted 172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226735 predicted 369
2 SASI_Mm01_00226736 predicted 1170
3 SASI_Mm01_00226737 predicted 1258
4 SASI_Mm01_00226738 predicted 1255
5 SASI_Mm01_00226739 predicted 372
6 SASI_Mm01_00226740 predicted 863
7 SASI_Mm01_00226741 predicted 1193
8 SASI_Mm01_00226742 predicted 1229
9 SASI_Mm01_00226743 predicted 1076
10 SASI_Mm01_00226744 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274180 predicted 377
2 SASI_Mm01_00274181 predicted 860
3 SASI_Mm01_00274182 predicted 853
4 SASI_Mm01_00274183 predicted 366
5 SASI_Mm01_00274184 predicted 865
6 SASI_Mm01_00274185 predicted 869
7 SASI_Mm01_00274186 predicted 856
8 SASI_Mm01_00274187 predicted 363
9 SASI_Mm01_00274188 predicted 365
10 SASI_Mm01_00274189 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237646 predicted 426
2 SASI_Mm01_00237647 predicted 430
3 SASI_Mm01_00237648 predicted 521
4 SASI_Mm01_00237649 predicted 337
5 SASI_Mm01_00237650 predicted 511
6 SASI_Mm01_00237651 predicted 454
7 SASI_Mm01_00237652 predicted 484
8 SASI_Mm01_00237653 predicted 336
9 SASI_Mm01_00237654 predicted 416
10 SASI_Mm01_00237655 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275362 predicted 686
2 SASI_Mm01_00275363 predicted 679
3 SASI_Mm01_00275364 predicted 768
4 SASI_Mm01_00275365 predicted 774
5 SASI_Mm01_00275366 predicted 376
6 SASI_Mm01_00275367 predicted 711
7 SASI_Mm01_00275368 predicted 741
8 SASI_Mm01_00275369 predicted 281
9 SASI_Mm01_00275370 predicted 585
10 SASI_Mm01_00275371 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029832
VALIDATED
DDRGK1 MISSION shRNA Bacterial Glycerol Stock
DDRGK domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-175s21c1
Sequence:CCGGACGGAGAACCACTGCACAATGCTCGAGCATTGTGCAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-674s21c1
Sequence:CCGGGGTAGAAGAAGAAGGTGTTAGCTCGAGCTAACACCTTCTTCTTCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-347s21c1
Sequence:CCGGGGATGAGAATGTGGGTCAAACCTCGAGGTTTGACCCACATTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-637s21c1
Sequence:CCGGAGCACGAGGAGTACCTGAAACCTCGAGGTTTCAGGTACTCCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029832.2-804s21c1
Sequence:CCGGAGGACTCAGGACGCCATAAACCTCGAGGTTTATGGCGTCCTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029832
VALIDATED
DDRGK1 MISSION shRNA shRNA Plasmid DNA
DDRGK domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-175s21c1
Sequence:CCGGACGGAGAACCACTGCACAATGCTCGAGCATTGTGCAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-674s21c1
Sequence:CCGGGGTAGAAGAAGAAGGTGTTAGCTCGAGCTAACACCTTCTTCTTCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-347s21c1
Sequence:CCGGGGATGAGAATGTGGGTCAAACCTCGAGGTTTGACCCACATTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-637s21c1
Sequence:CCGGAGCACGAGGAGTACCTGAAACCTCGAGGTTTCAGGTACTCCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029832.2-804s21c1
Sequence:CCGGAGGACTCAGGACGCCATAAACCTCGAGGTTTATGGCGTCCTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029832
VALIDATED
DDRGK1 MISSION shRNA Lentiviral Transduction Particles
DDRGK domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-175s21c1
Sequence:CCGGACGGAGAACCACTGCACAATGCTCGAGCATTGTGCAGTGGTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-674s21c1
Sequence:CCGGGGTAGAAGAAGAAGGTGTTAGCTCGAGCTAACACCTTCTTCTTCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-347s21c1
Sequence:CCGGGGATGAGAATGTGGGTCAAACCTCGAGGTTTGACCCACATTCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029832.2-637s21c1
Sequence:CCGGAGCACGAGGAGTACCTGAAACCTCGAGGTTTCAGGTACTCCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029832.2-804s21c1
Sequence:CCGGAGGACTCAGGACGCCATAAACCTCGAGGTTTATGGCGTCCTGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023935
VALIDATED
DDRGK1 MISSION shRNA Bacterial Glycerol Stock
DDRGK domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-789s21c1
Sequence:CCGGGGACTATAACAGGTGTGATTGCTCGAGCAATCACACCTGTTATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-55s21c1
Sequence:CCGGGGCTCTGCTAGTCGGCTTTATCTCGAGATAAAGCCGACTAGCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-1061s21c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023935.1-742s21c1
Sequence:CCGGACGCACTCAGGACACCATAAACTCGAGTTTATGGTGTCCTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1061s1c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1139s1c1
Sequence:CCGGGATCCTAGATAAGCAGGTGAACTCGAGTTCACCTGCTTATCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023935
VALIDATED
DDRGK1 MISSION shRNA shRNA Plasmid DNA
DDRGK domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-789s21c1
Sequence:CCGGGGACTATAACAGGTGTGATTGCTCGAGCAATCACACCTGTTATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-55s21c1
Sequence:CCGGGGCTCTGCTAGTCGGCTTTATCTCGAGATAAAGCCGACTAGCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-1061s21c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023935.1-742s21c1
Sequence:CCGGACGCACTCAGGACACCATAAACTCGAGTTTATGGTGTCCTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1061s1c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1139s1c1
Sequence:CCGGGATCCTAGATAAGCAGGTGAACTCGAGTTCACCTGCTTATCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023935
VALIDATED
DDRGK1 MISSION shRNA Lentiviral Transduction Particles
DDRGK domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-789s21c1
Sequence:CCGGGGACTATAACAGGTGTGATTGCTCGAGCAATCACACCTGTTATAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-55s21c1
Sequence:CCGGGGCTCTGCTAGTCGGCTTTATCTCGAGATAAAGCCGACTAGCAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023935.1-1061s21c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023935.1-742s21c1
Sequence:CCGGACGCACTCAGGACACCATAAACTCGAGTTTATGGTGTCCTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1061s1c1
Sequence:CCGGGCCAGGCAGTTATAGATTAAACTCGAGTTTAATCTATAACTGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023935.1-1139s1c1
Sequence:CCGGGATCCTAGATAAGCAGGTGAACTCGAGTTCACCTGCTTATCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks