EMAIL THIS PAGE TO A FRIEND

DDT

D-dopachrome tautomerase

64 Gene Product Result for
Synonyms: DDCT
UniProtKB ID: P30046, O00774, O60787, Q13534
Gene ID:
Human(1652) Summary: D-dopachrome tautomerase converts D-dopachrome into 5,6-dihydroxyindole. The DDT gene is related to the migration inhibitory factor (MIF) in terms of sequence, enzyme activity, and gene structure. DDT and MIF are closely linked on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(13202) D-dopachrome tautomerase
Rat(29318) D-dopachrome tautomerase
Zebrafish(415237) D-dopachrome tautomerase
chicken(416937) D-dopachrome tautomerase
cow(615999) D-dopachrome tautomerase
dog(607589) D-dopachrome tautomerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001084392 Rosetta Predictions human pricing
NM_001355 Rosetta Predictions human pricing
NM_024131 Rosetta Predictions rat pricing
NM_010027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001084392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317422 predicted 343
2 SASI_Hs02_00317423 predicted 352
3 SASI_Hs02_00317424 predicted 346
4 SASI_Hs02_00317425 predicted 382
5 SASI_Hs02_00317426 predicted 346
6 SASI_Hs02_00317427 predicted 382
7 SASI_Hs02_00317428 predicted 354
8 SASI_Hs02_00317429 predicted 354
9 SASI_Hs02_00317430 predicted 343
10 SASI_Hs02_00317431 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117738 predicted 396
2 SASI_Hs02_00331688 predicted 401
3 SASI_Hs01_00117739 predicted 400
4 SASI_Hs02_00331689 predicted 432
5 SASI_Hs01_00117741 predicted 396
6 SASI_Hs01_00117742 predicted 432
7 SASI_Hs01_00117743 predicted 404
8 SASI_Hs01_00117746 predicted 404
9 SASI_Hs01_00117747 predicted 397
10 SASI_Hs02_00331690 predicted 488
11 SASI_Hs01_00117740 predicted 226
12 SASI_Hs01_00117744 predicted 219
13 SASI_Hs01_00117745 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098912 predicted 205
2 SASI_Rn01_00098913 predicted 197
3 SASI_Rn01_00098914 predicted 246
4 SASI_Rn01_00098915 predicted 202
5 SASI_Rn01_00098916 predicted 359
6 SASI_Rn01_00098917 predicted 244
7 SASI_Rn01_00098919 predicted 338
8 SASI_Rn02_00263850 predicted 323
9 SASI_Rn01_00098920 predicted 207
10 SASI_Rn01_00098921 predicted 346
11 SASI_Rn01_00098918 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097025 predicted 278
2 SASI_Mm01_00097026 predicted 217
3 SASI_Mm01_00097027 predicted 276
4 SASI_Mm01_00097028 predicted 213
5 SASI_Mm01_00097029 predicted 272
6 SASI_Mm02_00317677 predicted 207
7 SASI_Mm01_00097031 predicted 212
8 SASI_Mm01_00097032 predicted 258
9 SASI_Mm01_00097033 predicted 383
10 SASI_Mm01_00097034 predicted 334
11 SASI_Mm01_00097030 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001355
DDT MISSION shRNA Bacterial Glycerol Stock
D-dopachrome tautomerase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-406s1c1
Sequence:CCGGGACCGGATACTTATCCGCTTTCTCGAGAAAGCGGATAAGTATCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-362s1c1
Sequence:CCGGCCCACTTCTTTGAGTTTCTCACTCGAGTGAGAAACTCAAAGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-369s1c1
Sequence:CCGGCTTTGAGTTTCTCACCAAGGACTCGAGTCCTTGGTGAGAAACTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-373s1c1
Sequence:CCGGGAGTTTCTCACCAAGGAGCTACTCGAGTAGCTCCTTGGTGAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-497s21c1
Sequence:CCGGGGGATCCAGGGCATCTGTGAACTCGAGTTCACAGATGCCCTGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-442s21c1
Sequence:CCGGCCTGGCAGATTGGCAAGATAGCTCGAGCTATCTTGCCAATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-510s21c1
Sequence:CCGGTCTGTGAACTGGCTGCTTCTTCTCGAGAAGAAGCAGCCAGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-224s21c1
Sequence:CCGGCAAACCTGCGGACCGCGTGAACTCGAGTTCACGCGGTCCGCAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-311s21c1
Sequence:CCGGCATCTCCTCCATCGGCGTAGTCTCGAGACTACGCCGATGGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-481s21c1
Sequence:CCGGTATGATTGGGCACGGAGGGATCTCGAGATCCCTCCGTGCCCAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001355
DDT MISSION shRNA shRNA Plasmid DNA
D-dopachrome tautomerase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-406s1c1
Sequence:CCGGGACCGGATACTTATCCGCTTTCTCGAGAAAGCGGATAAGTATCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-362s1c1
Sequence:CCGGCCCACTTCTTTGAGTTTCTCACTCGAGTGAGAAACTCAAAGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-369s1c1
Sequence:CCGGCTTTGAGTTTCTCACCAAGGACTCGAGTCCTTGGTGAGAAACTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-373s1c1
Sequence:CCGGGAGTTTCTCACCAAGGAGCTACTCGAGTAGCTCCTTGGTGAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-497s21c1
Sequence:CCGGGGGATCCAGGGCATCTGTGAACTCGAGTTCACAGATGCCCTGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-442s21c1
Sequence:CCGGCCTGGCAGATTGGCAAGATAGCTCGAGCTATCTTGCCAATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-510s21c1
Sequence:CCGGTCTGTGAACTGGCTGCTTCTTCTCGAGAAGAAGCAGCCAGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-224s21c1
Sequence:CCGGCAAACCTGCGGACCGCGTGAACTCGAGTTCACGCGGTCCGCAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-311s21c1
Sequence:CCGGCATCTCCTCCATCGGCGTAGTCTCGAGACTACGCCGATGGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-481s21c1
Sequence:CCGGTATGATTGGGCACGGAGGGATCTCGAGATCCCTCCGTGCCCAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001355
DDT MISSION shRNA Lentiviral Transduction Particles
D-dopachrome tautomerase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-406s1c1
Sequence:CCGGGACCGGATACTTATCCGCTTTCTCGAGAAAGCGGATAAGTATCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-362s1c1
Sequence:CCGGCCCACTTCTTTGAGTTTCTCACTCGAGTGAGAAACTCAAAGAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-369s1c1
Sequence:CCGGCTTTGAGTTTCTCACCAAGGACTCGAGTCCTTGGTGAGAAACTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001355.2-373s1c1
Sequence:CCGGGAGTTTCTCACCAAGGAGCTACTCGAGTAGCTCCTTGGTGAGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-497s21c1
Sequence:CCGGGGGATCCAGGGCATCTGTGAACTCGAGTTCACAGATGCCCTGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-442s21c1
Sequence:CCGGCCTGGCAGATTGGCAAGATAGCTCGAGCTATCTTGCCAATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001355.3-510s21c1
Sequence:CCGGTCTGTGAACTGGCTGCTTCTTCTCGAGAAGAAGCAGCCAGTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-224s21c1
Sequence:CCGGCAAACCTGCGGACCGCGTGAACTCGAGTTCACGCGGTCCGCAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-311s21c1
Sequence:CCGGCATCTCCTCCATCGGCGTAGTCTCGAGACTACGCCGATGGAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001355.3-481s21c1
Sequence:CCGGTATGATTGGGCACGGAGGGATCTCGAGATCCCTCCGTGCCCAATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010027
VALIDATED
DDT MISSION shRNA Bacterial Glycerol Stock
D-dopachrome tautomerase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-333s1c1
Sequence:CCGGCCGGATCGTTATCCGCTTCTTCTCGAGAAGAAGCGGATAACGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-191s1c1
Sequence:CCGGCCCTGTTGATGAACAAATCCACTCGAGTGGATTTGTTCATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010027.1-221s1c1
Sequence:CCGGGTGCTCACCTTCTGGTCTCTTCTCGAGAAGAGACCAGAAGGTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-364s1c1
Sequence:CCGGGCTTGGCAGATCGGAAAGAAACTCGAGTTTCTTTCCGATCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-168s1c1
Sequence:CCGGCGTTACGATACGACCTGGCATCTCGAGATGCCAGGTCGTATCGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010027
VALIDATED
DDT MISSION shRNA shRNA Plasmid DNA
D-dopachrome tautomerase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-333s1c1
Sequence:CCGGCCGGATCGTTATCCGCTTCTTCTCGAGAAGAAGCGGATAACGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-191s1c1
Sequence:CCGGCCCTGTTGATGAACAAATCCACTCGAGTGGATTTGTTCATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010027.1-221s1c1
Sequence:CCGGGTGCTCACCTTCTGGTCTCTTCTCGAGAAGAGACCAGAAGGTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-364s1c1
Sequence:CCGGGCTTGGCAGATCGGAAAGAAACTCGAGTTTCTTTCCGATCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-168s1c1
Sequence:CCGGCGTTACGATACGACCTGGCATCTCGAGATGCCAGGTCGTATCGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010027
VALIDATED
DDT MISSION shRNA Lentiviral Transduction Particles
D-dopachrome tautomerase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-333s1c1
Sequence:CCGGCCGGATCGTTATCCGCTTCTTCTCGAGAAGAAGCGGATAACGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-191s1c1
Sequence:CCGGCCCTGTTGATGAACAAATCCACTCGAGTGGATTTGTTCATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010027.1-221s1c1
Sequence:CCGGGTGCTCACCTTCTGGTCTCTTCTCGAGAAGAGACCAGAAGGTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-364s1c1
Sequence:CCGGGCTTGGCAGATCGGAAAGAAACTCGAGTTTCTTTCCGATCTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010027.1-168s1c1
Sequence:CCGGCGTTACGATACGACCTGGCATCTCGAGATGCCAGGTCGTATCGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks