EMAIL THIS PAGE TO A FRIEND

DDX10

DEAD (Asp-Glu-Ala-Asp) box polypeptide 10

127 Gene Product Result for
Synonyms: HRH-J8
UniProtKB ID: Q13206, B2RCQ3, Q5BJD8
Gene ID:
Human(1662) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
Mouse(77591) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Rat(300710) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
sheep(101106358) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Domestic Rabbit(100344285) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
naked mole-rat(101711461) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
domestic guinea pig(100718542) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Zebrafish(569118) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
cow(528483) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Horse(100069845) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
chicken(418965) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
domestic cat(101090207) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
dog(479448) DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004398 Rosetta Predictions human pricing
NM_001106820 Rosetta Predictions rat pricing
NM_029936 Rosetta Predictions mouse pricing
XM_284494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337522 predicted 1457
2 SASI_Hs01_00070034 predicted 2727
3 SASI_Hs01_00070035 predicted 1211
4 SASI_Hs01_00070036 predicted 525
5 SASI_Hs01_00070037 predicted 307
6 SASI_Hs01_00070039 predicted 1271
7 SASI_Hs01_00070040 predicted 2715
8 SASI_Hs01_00070042 predicted 745
9 SASI_Hs02_00337523 predicted 1197
10 SASI_Hs01_00070043 predicted 1281
11 SASI_Hs01_00070038 predicted 1438
12 SASI_Hs01_00070041 predicted 2666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222728 predicted 2779
2 SASI_Rn02_00222729 predicted 2084
3 SASI_Rn02_00222730 predicted 773
4 SASI_Rn02_00222731 predicted 588
5 SASI_Rn02_00222732 predicted 562
6 SASI_Rn02_00222733 predicted 1605
7 SASI_Rn02_00222734 predicted 1340
8 SASI_Rn02_00222735 predicted 603
9 SASI_Rn02_00222736 predicted 2118
10 SASI_Rn02_00222737 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336220 predicted 1187
2 SASI_Mm02_00336221 predicted 742
3 SASI_Mm02_00336222 predicted 569
4 SASI_Mm02_00336223 predicted 534
5 SASI_Mm02_00336224 predicted 1066
6 SASI_Mm02_00336225 predicted 810
7 SASI_Mm02_00336226 predicted 2691
8 SASI_Mm02_00336227 predicted 1527
9 SASI_Mm02_00336228 predicted 1259
10 SASI_Mm02_00336229 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237395 predicted 1371
2 SASI_Mm01_00237396 predicted 1399
3 SASI_Mm01_00237397 predicted 947
4 SASI_Mm01_00237398 predicted 1038
5 SASI_Mm01_00237399 predicted 1958
6 SASI_Mm01_00237400 predicted 769
7 SASI_Mm01_00237401 predicted 1245
8 SASI_Mm01_00237402 predicted 1272
9 SASI_Mm01_00237403 predicted 1017
10 SASI_Mm01_00237404 predicted 1729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004398
VALIDATED
DDX10 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-441s1c1
Sequence:CCGGCCAGTGCTGGAAGCCTTATATCTCGAGATATAAGGCTTCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-1651s1c1
Sequence:CCGGCCGATAAAGTAATTGAGCCAACTCGAGTTGGCTCAATTACTTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1638s21c1
Sequence:CCGGGTAAGGAGCCAAGCCGATAAACTCGAGTTTATCGGCTTGGCTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-590s21c1
Sequence:CCGGCATTGGTGGAAAGGATCTAAACTCGAGTTTAGATCCTTTCCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1530s21c1
Sequence:GTACCGGGATGTGAGCAAGTTACCTATACTCGAGTATAGGTAACTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1168s21c1
Sequence:GTACCGGTACTCTTTGCTACTGATATTGCTCGAGCAATATCAGTAGCAAAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-2795s21c1
Sequence:CCGGCATTCCCAAAGGGCACATTTCCTCGAGGAAATGTGCCCTTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004398
VALIDATED
DDX10 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-441s1c1
Sequence:CCGGCCAGTGCTGGAAGCCTTATATCTCGAGATATAAGGCTTCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-1651s1c1
Sequence:CCGGCCGATAAAGTAATTGAGCCAACTCGAGTTGGCTCAATTACTTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1638s21c1
Sequence:CCGGGTAAGGAGCCAAGCCGATAAACTCGAGTTTATCGGCTTGGCTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-590s21c1
Sequence:CCGGCATTGGTGGAAAGGATCTAAACTCGAGTTTAGATCCTTTCCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1530s21c1
Sequence:GTACCGGGATGTGAGCAAGTTACCTATACTCGAGTATAGGTAACTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1168s21c1
Sequence:GTACCGGTACTCTTTGCTACTGATATTGCTCGAGCAATATCAGTAGCAAAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-2795s21c1
Sequence:CCGGCATTCCCAAAGGGCACATTTCCTCGAGGAAATGTGCCCTTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004398
VALIDATED
DDX10 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-441s1c1
Sequence:CCGGCCAGTGCTGGAAGCCTTATATCTCGAGATATAAGGCTTCCAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004398.2-1651s1c1
Sequence:CCGGCCGATAAAGTAATTGAGCCAACTCGAGTTGGCTCAATTACTTTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1638s21c1
Sequence:CCGGGTAAGGAGCCAAGCCGATAAACTCGAGTTTATCGGCTTGGCTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-590s21c1
Sequence:CCGGCATTGGTGGAAAGGATCTAAACTCGAGTTTAGATCCTTTCCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1530s21c1
Sequence:GTACCGGGATGTGAGCAAGTTACCTATACTCGAGTATAGGTAACTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-1168s21c1
Sequence:GTACCGGTACTCTTTGCTACTGATATTGCTCGAGCAATATCAGTAGCAAAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004398.2-2795s21c1
Sequence:CCGGCATTCCCAAAGGGCACATTTCCTCGAGGAAATGTGCCCTTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029936
VALIDATED
DDX10 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-968s21c1
Sequence:CCGGACGTTGGAACAGAACTATATACTCGAGTATATAGTTCTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-2761s21c1
Sequence:CCGGTTTGATACCTCTGGATATTACCTCGAGGTAATATCCAGAGGTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1339s21c1
Sequence:CCGGAGAAGATGGAGAAGCGTTATTCTCGAGAATAACGCTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1289s21c1
Sequence:CCGGGAGGATGCCAACACGTATATTCTCGAGAATATACGTGTTGGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1578s21c1
Sequence:CCGGATGTGAGCAAGTTACCTATTACTCGAGTAATAGGTAACTTGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029936
VALIDATED
DDX10 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-968s21c1
Sequence:CCGGACGTTGGAACAGAACTATATACTCGAGTATATAGTTCTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-2761s21c1
Sequence:CCGGTTTGATACCTCTGGATATTACCTCGAGGTAATATCCAGAGGTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1339s21c1
Sequence:CCGGAGAAGATGGAGAAGCGTTATTCTCGAGAATAACGCTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1289s21c1
Sequence:CCGGGAGGATGCCAACACGTATATTCTCGAGAATATACGTGTTGGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1578s21c1
Sequence:CCGGATGTGAGCAAGTTACCTATTACTCGAGTAATAGGTAACTTGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029936
VALIDATED
DDX10 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-968s21c1
Sequence:CCGGACGTTGGAACAGAACTATATACTCGAGTATATAGTTCTGTTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-2761s21c1
Sequence:CCGGTTTGATACCTCTGGATATTACCTCGAGGTAATATCCAGAGGTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1339s21c1
Sequence:CCGGAGAAGATGGAGAAGCGTTATTCTCGAGAATAACGCTTCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1289s21c1
Sequence:CCGGGAGGATGCCAACACGTATATTCTCGAGAATATACGTGTTGGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029936.2-1578s21c1
Sequence:CCGGATGTGAGCAAGTTACCTATTACTCGAGTAATAGGTAACTTGCTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks