EMAIL THIS PAGE TO A FRIEND

DDX11

DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11

92 Gene Product Result for
Synonyms: CHL1 CHLR1 KRG2 WABS
Gene ID:
Human(1663) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(320209) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Rat(316767) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Zebrafish(492353) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
dog(486745) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
chicken(418144) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
domestic cat(101097815) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Horse(100057138) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
naked mole-rat(101721808) DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004399 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004399 Rosetta Predictions human pricing
NM_030653 Rosetta Predictions human pricing
NM_152438 Rosetta Predictions human pricing
XM_001070646 Rosetta Predictions rat pricing
XM_237570 Rosetta Predictions rat pricing
NM_001003919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175316 predicted 259
2 SASI_Hs01_00175317 predicted 297
3 SASI_Hs01_00175318 predicted 1717
4 SASI_Hs01_00175319 predicted 391
5 SASI_Hs01_00175320 predicted 2870
6 SASI_Hs02_00337524 predicted 1736
7 SASI_Hs01_00175321 predicted 315
8 SASI_Hs01_00175322 predicted 581
9 SASI_Hs01_00175323 predicted 746
10 SASI_Hs01_00175324 predicted 840
11 SASI_Hs01_00175325 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224835 predicted 257
2 SASI_Hs01_00224836 predicted 305
3 SASI_Hs01_00224837 predicted 1715
4 SASI_Hs01_00224838 predicted 395
5 SASI_Hs01_00224839 predicted 3028
6 SASI_Hs02_00358232 predicted 1735
7 SASI_Hs01_00224840 predicted 320
8 SASI_Hs01_00224841 predicted 583
9 SASI_Hs01_00224842 predicted 748
10 SASI_Hs01_00224843 predicted 846
11 SASI_Hs01_00224844 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366179 predicted 262
2 SASI_Hs02_00366180 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332336 predicted 2096
2 SASI_Rn02_00332337 predicted 688
3 SASI_Rn02_00332338 predicted 2680
4 SASI_Rn02_00332339 predicted 1700
5 SASI_Rn02_00332340 predicted 1347
6 SASI_Rn02_00332341 predicted 2420
7 SASI_Rn02_00332342 predicted 1919
8 SASI_Rn02_00332343 predicted 2403
9 SASI_Rn02_00332344 predicted 1446
10 SASI_Rn02_00332345 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391049 predicted 2181
2 SASI_Rn02_00391050 predicted 759
3 SASI_Rn02_00391051 predicted 2755
4 SASI_Rn02_00391052 predicted 1781
5 SASI_Rn02_00391053 predicted 1405
6 SASI_Rn02_00391054 predicted 1994
7 SASI_Rn02_00391055 predicted 2485
8 SASI_Rn02_00391056 predicted 144
9 SASI_Rn02_00391057 predicted 2519
10 SASI_Rn02_00391058 predicted 2571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286364 predicted 2437
2 SASI_Mm02_00286365 predicted 2633
3 SASI_Mm02_00286366 predicted 320
4 SASI_Mm02_00286367 predicted 2574
5 SASI_Mm02_00286368 predicted 289
6 SASI_Mm02_00286369 predicted 2918
7 SASI_Mm02_00286370 predicted 1517
8 SASI_Mm02_00286371 predicted 427
9 SASI_Mm02_00286372 predicted 2608
10 SASI_Mm02_00286373 predicted 2656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004399
VALIDATED
DDX11 MISSION shRNA Bacterial Glycerol Stock
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1073s21c1
Sequence:CCGGCCTAGGTTCTGTGCAGCTTATCTCGAGATAAGCTGCACAGAACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1675s21c1
Sequence:CCGGTGAAGACCATCAACGACTTTCCTCGAGGAAAGTCGTTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-358s21c1
Sequence:CCGGCTGGCAAGATTGGGATATTTGCTCGAGCAAATATCCCAATCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-2287s21c1
Sequence:CCGGGAGAGCTGCCTCAGATGATATCTCGAGATATCATCTGAGGCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004399.2-3259s21c1
Sequence:CCGGCACTCTCTGGTCTCAATTTAACTCGAGTTAAATTGAGACCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-435s1c1
Sequence:CCGGCGACTCCTTGAAACTGGAACTCTCGAGAGTTCCAGTTTCAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-459s1c1
Sequence:CCGGCCCTTACATGATGAGAAAGATCTCGAGATCTTTCTCATCATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-1670s1c1
Sequence:CCGGGATCGACAACATCAACCTGTTCTCGAGAACAGGTTGATGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-2706s1c1
Sequence:CCGGGTGGAGGTCAAAGCTACCTTTCTCGAGAAAGGTAGCTTTGACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-318s1c1
Sequence:CCGGGCTGGCAAGAGTGGGATATTTCTCGAGAAATATCCCACTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004399
VALIDATED
DDX11 MISSION shRNA shRNA Plasmid DNA
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1073s21c1
Sequence:CCGGCCTAGGTTCTGTGCAGCTTATCTCGAGATAAGCTGCACAGAACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1675s21c1
Sequence:CCGGTGAAGACCATCAACGACTTTCCTCGAGGAAAGTCGTTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-358s21c1
Sequence:CCGGCTGGCAAGATTGGGATATTTGCTCGAGCAAATATCCCAATCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-2287s21c1
Sequence:CCGGGAGAGCTGCCTCAGATGATATCTCGAGATATCATCTGAGGCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004399.2-3259s21c1
Sequence:CCGGCACTCTCTGGTCTCAATTTAACTCGAGTTAAATTGAGACCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-435s1c1
Sequence:CCGGCGACTCCTTGAAACTGGAACTCTCGAGAGTTCCAGTTTCAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-459s1c1
Sequence:CCGGCCCTTACATGATGAGAAAGATCTCGAGATCTTTCTCATCATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-1670s1c1
Sequence:CCGGGATCGACAACATCAACCTGTTCTCGAGAACAGGTTGATGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-2706s1c1
Sequence:CCGGGTGGAGGTCAAAGCTACCTTTCTCGAGAAAGGTAGCTTTGACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-318s1c1
Sequence:CCGGGCTGGCAAGAGTGGGATATTTCTCGAGAAATATCCCACTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004399
VALIDATED
DDX11 MISSION shRNA Lentiviral Transduction Particles
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1073s21c1
Sequence:CCGGCCTAGGTTCTGTGCAGCTTATCTCGAGATAAGCTGCACAGAACCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-1675s21c1
Sequence:CCGGTGAAGACCATCAACGACTTTCCTCGAGGAAAGTCGTTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-358s21c1
Sequence:CCGGCTGGCAAGATTGGGATATTTGCTCGAGCAAATATCCCAATCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004399.2-2287s21c1
Sequence:CCGGGAGAGCTGCCTCAGATGATATCTCGAGATATCATCTGAGGCAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004399.2-3259s21c1
Sequence:CCGGCACTCTCTGGTCTCAATTTAACTCGAGTTAAATTGAGACCAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-435s1c1
Sequence:CCGGCGACTCCTTGAAACTGGAACTCTCGAGAGTTCCAGTTTCAAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-459s1c1
Sequence:CCGGCCCTTACATGATGAGAAAGATCTCGAGATCTTTCTCATCATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004399.1-1670s1c1
Sequence:CCGGGATCGACAACATCAACCTGTTCTCGAGAACAGGTTGATGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-2706s1c1
Sequence:CCGGGTGGAGGTCAAAGCTACCTTTCTCGAGAAAGGTAGCTTTGACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004399.1-318s1c1
Sequence:CCGGGCTGGCAAGAGTGGGATATTTCTCGAGAAATATCCCACTCTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003919
VALIDATED
DDX11 MISSION shRNA Bacterial Glycerol Stock
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-3346s1c1
Sequence:CCGGCCTCATAAACTAAGAGGCATTCTCGAGAATGCCTCTTAGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-1090s1c1
Sequence:CCGGGTGAAGGACATGGAACAACTTCTCGAGAAGTTGTTCCATGTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2530s1c1
Sequence:CCGGGCCTACTTGAATCAGACACTTCTCGAGAAGTGTCTGATTCAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-682s1c1
Sequence:CCGGCACCTGGTTCTGGCAGAATATCTCGAGATATTCTGCCAGAACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2778s1c1
Sequence:CCGGGCGGAAGTTTCATCGAGAGAACTCGAGTTCTCTCGATGAAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003919
VALIDATED
DDX11 MISSION shRNA shRNA Plasmid DNA
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-3346s1c1
Sequence:CCGGCCTCATAAACTAAGAGGCATTCTCGAGAATGCCTCTTAGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-1090s1c1
Sequence:CCGGGTGAAGGACATGGAACAACTTCTCGAGAAGTTGTTCCATGTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2530s1c1
Sequence:CCGGGCCTACTTGAATCAGACACTTCTCGAGAAGTGTCTGATTCAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-682s1c1
Sequence:CCGGCACCTGGTTCTGGCAGAATATCTCGAGATATTCTGCCAGAACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2778s1c1
Sequence:CCGGGCGGAAGTTTCATCGAGAGAACTCGAGTTCTCTCGATGAAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003919
VALIDATED
DDX11 MISSION shRNA Lentiviral Transduction Particles
DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-3346s1c1
Sequence:CCGGCCTCATAAACTAAGAGGCATTCTCGAGAATGCCTCTTAGTTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-1090s1c1
Sequence:CCGGGTGAAGGACATGGAACAACTTCTCGAGAAGTTGTTCCATGTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2530s1c1
Sequence:CCGGGCCTACTTGAATCAGACACTTCTCGAGAAGTGTCTGATTCAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003919.1-682s1c1
Sequence:CCGGCACCTGGTTCTGGCAGAATATCTCGAGATATTCTGCCAGAACCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003919.1-2778s1c1
Sequence:CCGGGCGGAAGTTTCATCGAGAGAACTCGAGTTCTCTCGATGAAACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks