EMAIL THIS PAGE TO A FRIEND

DDX12P

DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12, pseudogene

262 Gene Product Result for
Synonyms: CHLR2 DDX12
Species: Human DDX12P(440081)
UniProtKB ID: Q92771
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301292 ANTI-DDX12 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_495908 Rosetta Predictions human pricing
XM_927232 Rosetta Predictions human pricing
XM_931826 Rosetta Predictions human pricing
XM_931833 Rosetta Predictions human pricing
XM_931836 Rosetta Predictions human pricing
XM_931839 Rosetta Predictions human pricing
XM_931845 Rosetta Predictions human pricing
XM_931862 Rosetta Predictions human pricing
XM_931867 Rosetta Predictions human pricing
XM_931872 Rosetta Predictions human pricing
XM_931876 Rosetta Predictions human pricing
XM_931883 Rosetta Predictions human pricing
XM_931887 Rosetta Predictions human pricing
XM_931891 Rosetta Predictions human pricing
XM_931895 Rosetta Predictions human pricing
XM_931902 Rosetta Predictions human pricing
XM_931907 Rosetta Predictions human pricing
XM_931915 Rosetta Predictions human pricing
XM_931918 Rosetta Predictions human pricing
XM_931927 Rosetta Predictions human pricing
XM_931933 Rosetta Predictions human pricing
XM_931941 Rosetta Predictions human pricing
XM_931947 Rosetta Predictions human pricing
XM_931954 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283439 predicted 1527
2 SASI_Hs02_00479929 predicted 200
3 SASI_Hs01_00283441 predicted 1568
4 SASI_Hs01_00283442 predicted 2827
5 SASI_Hs01_00283443 predicted 1362
6 SASI_Hs01_00283444 predicted 1538
7 SASI_Hs01_00283445 predicted 391
8 SASI_Hs01_00283446 predicted 557
9 SASI_Hs01_00283447 predicted 647
10 SASI_Hs02_00479930 predicted 1400
11 SASI_Hs01_00283440 predicted 2003
12 SASI_Hs01_00283448 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250428 predicted 758
2 SASI_Hs01_00250429 predicted 793
3 SASI_Hs01_00250430 predicted 2219
4 SASI_Hs01_00250431 predicted 2078
5 SASI_Hs01_00250432 predicted 2262
6 SASI_Hs01_00250433 predicted 3514
7 SASI_Hs01_00250434 predicted 2050
8 SASI_Hs01_00250435 predicted 2234
9 SASI_Hs01_00250436 predicted 811
10 SASI_Hs01_00250437 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290695 predicted 757
2 SASI_Hs01_00290696 predicted 801
3 SASI_Hs01_00290697 predicted 1497
4 SASI_Hs01_00290698 predicted 843
5 SASI_Hs01_00290699 predicted 1476
6 SASI_Hs01_00290700 predicted 809
7 SASI_Hs01_00290701 predicted 1078
8 SASI_Hs01_00290702 predicted 1011
9 SASI_Hs01_00290703 predicted 859
10 SASI_Hs01_00290704 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481450 predicted 227
2 SASI_Hs01_00299273 predicted 318
3 SASI_Hs01_00299265 predicted 387
4 SASI_Hs02_00481451 predicted 298
5 SASI_Hs01_00299267 predicted 203
6 SASI_Hs02_00481452 predicted 1231
7 SASI_Hs01_00299270 predicted 392
8 SASI_Hs01_00299271 predicted 553
9 SASI_Hs01_00299272 predicted 646
10 SASI_Hs02_00481453 predicted 517
11 SASI_Hs01_00299264 predicted 751
12 SASI_Hs01_00299266 predicted 797
13 SASI_Hs01_00299268 predicted 846
14 SASI_Hs01_00299269 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296539 predicted 281
2 SASI_Hs01_00296540 predicted 265
3 SASI_Hs01_00296541 predicted 306
4 SASI_Hs01_00296542 predicted 237
5 SASI_Hs01_00296543 predicted 313
6 SASI_Hs01_00296544 predicted 358
7 SASI_Hs01_00296545 predicted 214
8 SASI_Hs01_00296546 predicted 312
9 SASI_Hs01_00296547 predicted 228
10 SASI_Hs01_00296548 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287009 predicted 1279
2 SASI_Hs01_00287010 predicted 1298
3 SASI_Hs01_00287011 predicted 1295
4 SASI_Hs01_00287012 predicted 1282
5 SASI_Hs01_00287013 predicted 1237
6 SASI_Hs01_00287014 predicted 1235
7 SASI_Hs01_00287015 predicted 1275
8 SASI_Hs01_00287016 predicted 1287
9 SASI_Hs01_00287017 predicted 1520
10 SASI_Hs01_00287018 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291413 predicted 2836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265366 predicted 251
2 SASI_Hs01_00265367 predicted 254
3 SASI_Hs01_00265368 predicted 261
4 SASI_Hs01_00265369 predicted 241
5 SASI_Hs01_00265370 predicted 246
6 SASI_Hs01_00265371 predicted 251
7 SASI_Hs01_00265372 predicted 372
8 SASI_Hs01_00265373 predicted 190
9 SASI_Hs01_00265374 predicted 192
10 SASI_Hs01_00265375 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282606 predicted 756
2 SASI_Hs01_00282607 predicted 801
3 SASI_Hs01_00282608 predicted 886
4 SASI_Hs01_00282609 predicted 851
5 SASI_Hs01_00282610 predicted 808
6 SASI_Hs01_00282611 predicted 1010
7 SASI_Hs01_00282612 predicted 850
8 SASI_Hs01_00282613 predicted 857
9 SASI_Hs01_00282614 predicted 786
10 SASI_Hs01_00282615 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292316 predicted 753
2 SASI_Hs01_00292317 predicted 1082
3 SASI_Hs01_00292318 predicted 799
4 SASI_Hs01_00292319 predicted 888
5 SASI_Hs01_00292320 predicted 852
6 SASI_Hs01_00292321 predicted 815
7 SASI_Hs01_00292322 predicted 1081
8 SASI_Hs01_00292323 predicted 1247
9 SASI_Hs01_00292324 predicted 1344
10 SASI_Hs01_00292325 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253937 predicted 759
2 SASI_Hs01_00253938 predicted 795
3 SASI_Hs01_00253939 predicted 2212
4 SASI_Hs01_00253940 predicted 2078
5 SASI_Hs01_00253941 predicted 2257
6 SASI_Hs01_00253942 predicted 3533
7 SASI_Hs01_00253943 predicted 2055
8 SASI_Hs01_00253944 predicted 2226
9 SASI_Hs01_00253945 predicted 814
10 SASI_Hs01_00253946 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278769 predicted 753
2 SASI_Hs01_00278770 predicted 799
3 SASI_Hs01_00278771 predicted 2216
4 SASI_Hs01_00278772 predicted 2259
5 SASI_Hs01_00278773 predicted 2845
6 SASI_Hs01_00278774 predicted 2051
7 SASI_Hs01_00278775 predicted 2858
8 SASI_Hs01_00278776 predicted 2232
9 SASI_Hs01_00278777 predicted 808
10 SASI_Hs01_00278778 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257223 predicted 2467
2 SASI_Hs01_00257224 predicted 2603
3 SASI_Hs01_00257225 predicted 2466
4 SASI_Hs01_00257226 predicted 2658
5 SASI_Hs01_00257227 predicted 3899
6 SASI_Hs01_00257228 predicted 2447
7 SASI_Hs01_00257229 predicted 2622
8 SASI_Hs01_00257230 predicted 2430
9 SASI_Hs01_00257231 predicted 2483
10 SASI_Hs01_00257232 predicted 3371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251584 predicted 755
2 SASI_Hs01_00251585 predicted 801
3 SASI_Hs01_00251586 predicted 2216
4 SASI_Hs01_00251587 predicted 889
5 SASI_Hs01_00251588 predicted 2667
6 SASI_Hs01_00251589 predicted 2684
7 SASI_Hs01_00251590 predicted 809
8 SASI_Hs01_00251591 predicted 1077
9 SASI_Hs01_00251592 predicted 1243
10 SASI_Hs01_00251593 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290493 predicted 2498
2 SASI_Hs01_00290494 predicted 2663
3 SASI_Hs01_00290495 predicted 2820
4 SASI_Hs01_00290496 predicted 2810
5 SASI_Hs01_00290497 predicted 2760
6 SASI_Hs01_00290498 predicted 2208
7 SASI_Hs01_00290499 predicted 2303
8 SASI_Hs01_00290500 predicted 2597
9 SASI_Hs01_00290501 predicted 2257
10 SASI_Hs01_00290502 predicted 3098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250592 predicted 1409
2 SASI_Hs01_00250593 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289934 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258070 predicted 2689
2 SASI_Hs01_00258071 predicted 2958
3 SASI_Hs01_00258072 predicted 2950
4 SASI_Hs01_00258073 predicted 3432
5 SASI_Hs01_00258074 predicted 2396
6 SASI_Hs01_00258075 predicted 2500
7 SASI_Hs01_00258076 predicted 2910
8 SASI_Hs01_00258077 predicted 2904
9 SASI_Hs01_00258078 predicted 2440
10 SASI_Hs01_00258079 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271613 predicted 2330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249834 predicted 417
2 SASI_Hs01_00249835 predicted 458
3 SASI_Hs01_00249836 predicted 1881
4 SASI_Hs01_00249837 predicted 1732
5 SASI_Hs01_00249838 predicted 1930
6 SASI_Hs01_00249839 predicted 3196
7 SASI_Hs01_00249840 predicted 1717
8 SASI_Hs01_00249841 predicted 1892
9 SASI_Hs01_00249842 predicted 479
10 SASI_Hs01_00249843 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270379 predicted 1570
2 SASI_Hs01_00270380 predicted 1426
3 SASI_Hs01_00270381 predicted 1616
4 SASI_Hs01_00270382 predicted 2893
5 SASI_Hs01_00270383 predicted 1398
6 SASI_Hs01_00270384 predicted 1583
7 SASI_Hs01_00270385 predicted 426
8 SASI_Hs01_00270386 predicted 598
9 SASI_Hs01_00270387 predicted 695
10 SASI_Hs01_00270388 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280459 predicted 1551
2 SASI_Hs01_00280460 predicted 221
3 SASI_Hs01_00280461 predicted 1598
4 SASI_Hs01_00280462 predicted 2866
5 SASI_Hs01_00280463 predicted 1389
6 SASI_Hs01_00280464 predicted 1567
7 SASI_Hs01_00280465 predicted 416
8 SASI_Hs01_00280466 predicted 576
9 SASI_Hs01_00280467 predicted 673
10 SASI_Hs01_00280468 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301158 predicted 2745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289459 predicted 755
2 SASI_Hs01_00289460 predicted 791
3 SASI_Hs01_00289461 predicted 2215
4 SASI_Hs01_00289462 predicted 2077
5 SASI_Hs01_00289463 predicted 2260
6 SASI_Hs01_00289464 predicted 3371
7 SASI_Hs01_00289465 predicted 2050
8 SASI_Hs01_00289466 predicted 2231
9 SASI_Hs01_00289467 predicted 808
10 SASI_Hs01_00289468 predicted 1075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004400
DDX12P MISSION shRNA Bacterial Glycerol Stock
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-1619s21c1
Sequence:CCGGTGAAGACTATCAACGACTTTCCTCGAGGAAAGTCGTTGATAGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-301s21c1
Sequence:CCGGGCTGGCAAGATTGGGATATTTCTCGAGAAATATCCCAATCTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-641s21c1
Sequence:CCGGACAGGGTGCAGCTCAAGTATGCTCGAGCATACTTGAGCTGCACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004400.1-3350s21c1
Sequence:CCGGGCTCACTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-2628s21c1
Sequence:CCGGGATGGCCTACTTGGATCAAACCTCGAGGTTTGATCCAAGTAGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004400
DDX12P MISSION shRNA shRNA Plasmid DNA
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-1619s21c1
Sequence:CCGGTGAAGACTATCAACGACTTTCCTCGAGGAAAGTCGTTGATAGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-301s21c1
Sequence:CCGGGCTGGCAAGATTGGGATATTTCTCGAGAAATATCCCAATCTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-641s21c1
Sequence:CCGGACAGGGTGCAGCTCAAGTATGCTCGAGCATACTTGAGCTGCACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004400.1-3350s21c1
Sequence:CCGGGCTCACTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-2628s21c1
Sequence:CCGGGATGGCCTACTTGGATCAAACCTCGAGGTTTGATCCAAGTAGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004400
DDX12P MISSION shRNA Lentiviral Transduction Particles
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-1619s21c1
Sequence:CCGGTGAAGACTATCAACGACTTTCCTCGAGGAAAGTCGTTGATAGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-301s21c1
Sequence:CCGGGCTGGCAAGATTGGGATATTTCTCGAGAAATATCCCAATCTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-641s21c1
Sequence:CCGGACAGGGTGCAGCTCAAGTATGCTCGAGCATACTTGAGCTGCACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004400.1-3350s21c1
Sequence:CCGGGCTCACTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004400.1-2628s21c1
Sequence:CCGGGATGGCCTACTTGGATCAAACCTCGAGGTTTGATCCAAGTAGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)