EMAIL THIS PAGE TO A FRIEND

DDX17

DEAD (Asp-Glu-Ala-Asp) box helicase 17

Synonyms: P72 RH70
UniProtKB ID: Q92841, B1AHM0, Q69YT1, Q6ICD6
Gene ID:
Human(10521) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and splicesosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an ATPase activated by a variety of RNA species, but not by dsDNA. This protein, and that encoded by DDX5 gene, are more closely related to each other than to any other member of the DEAD box family. This gene can encode multiple isoforms due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) start codon. [provided by RefSeq, Apr 2011]
Mouse(67040) DEAD (Asp-Glu-Ala-Asp) box polypeptide 17
Rat(315133) DEAD (Asp-Glu-Ala-Asp) box helicase 17
chicken(418024) DEAD (Asp-Glu-Ala-Asp) box helicase 17
dog(474508) DEAD (Asp-Glu-Ala-Asp) box helicase 17
domestic cat(101080643) DEAD (Asp-Glu-Ala-Asp) box helicase 17
cow(514323) DEAD (Asp-Glu-Ala-Asp) box polypeptide 17
Horse(100070063) DEAD (Asp-Glu-Ala-Asp) box helicase 17
sheep(101121675) DEAD (Asp-Glu-Ala-Asp) box helicase 17
naked mole-rat(101706724) DEAD (Asp-Glu-Ala-Asp) box helicase 17
domestic guinea pig(100728053) DEAD (Asp-Glu-Ala-Asp) box helicase 17
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41029 Anti-DDX17 antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, canine, mouse, human, bovine, horse, rabbit
immunohistochemistry, western blot pricing
SAB2100550 Anti-DDX17 antibody produced in rabbit affinity isolated antibody bovine, canine, human, horse, rabbit, mouse, guinea pig
western blot pricing
HPA063142 Anti-DDX17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701258 Anti-DDX17 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098504 Rosetta Predictions human pricing
NM_001098505 Rosetta Predictions human pricing
NM_006386 Rosetta Predictions human pricing
NM_030881 Rosetta Predictions human pricing
NM_001015018 Rosetta Predictions rat pricing
NM_001040187 Rosetta Predictions mouse pricing
NM_152806 Rosetta Predictions mouse pricing
NM_199079 Rosetta Predictions mouse pricing
NM_199080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319117 predicted 1995
2 SASI_Hs02_00319118 predicted 1992
3 SASI_Hs02_00319119 predicted 1196
4 SASI_Hs02_00319120 predicted 773
5 SASI_Hs02_00319121 predicted 1392
6 SASI_Hs02_00319122 predicted 2298
7 SASI_Hs02_00319123 predicted 1304
8 SASI_Hs02_00319124 predicted 979
9 SASI_Hs02_00319125 predicted 715
10 SASI_Hs02_00319126 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319127 predicted 852
2 SASI_Hs02_00319128 predicted 851
3 SASI_Hs02_00319129 predicted 766
4 SASI_Hs02_00319130 predicted 1286
5 SASI_Hs02_00319131 predicted 982
6 SASI_Hs02_00319132 predicted 808
7 SASI_Hs02_00319133 predicted 1158
8 SASI_Hs02_00319134 predicted 913
9 SASI_Hs02_00319135 predicted 909
10 SASI_Hs02_00319136 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135644 predicted 1988
2 SASI_Hs02_00341458 predicted 1990
3 SASI_Hs01_00135645 predicted 1196
4 SASI_Hs01_00135646 predicted 772
5 SASI_Hs02_00341459 predicted 1392
6 SASI_Hs01_00135647 predicted 2289
7 SASI_Hs01_00135648 predicted 1308
8 SASI_Hs01_00135649 predicted 978
9 SASI_Hs01_00135650 predicted 715
10 SASI_Hs01_00135652 predicted 1473
11 SASI_Hs01_00135651 predicted 872
12 SASI_Hs01_00135653 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211788 predicted 861
2 SASI_Hs01_00211790 predicted 769
3 SASI_Hs01_00211791 predicted 1285
4 SASI_Hs01_00211792 predicted 991
5 SASI_Hs01_00211793 predicted 823
6 SASI_Hs01_00211794 predicted 1167
7 SASI_Hs02_00358413 predicted 913
8 SASI_Hs01_00211796 predicted 915
9 SASI_Hs01_00211789 predicted 860
10 SASI_Hs01_00211797 predicted 892
11 SASI_Hs01_00211795 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202043 predicted 621
2 SASI_Rn02_00202044 predicted 329
3 SASI_Rn02_00202045 predicted 370
4 SASI_Rn02_00202046 predicted 493
5 SASI_Rn02_00202047 predicted 256
6 SASI_Rn02_00202048 predicted 514
7 SASI_Rn02_00202049 predicted 680
8 SASI_Rn02_00202050 predicted 558
9 SASI_Rn02_00202051 predicted 689
10 SASI_Rn02_00202052 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091454 predicted 2143
2 SASI_Mm01_00091455 predicted 2820
3 SASI_Mm02_00290308 predicted 2944
4 SASI_Mm01_00091456 predicted 791
5 SASI_Mm01_00091457 predicted 1793
6 SASI_Mm01_00091458 predicted 885
7 SASI_Mm01_00091459 predicted 628
8 SASI_Mm01_00091460 predicted 1084
9 SASI_Mm01_00091461 predicted 1727
10 SASI_Mm01_00091463 predicted 1876
11 SASI_Mm01_00091462 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167871 predicted 1450
2 SASI_Mm01_00167872 predicted 2119
3 SASI_Mm02_00342807 predicted 2242
4 SASI_Mm01_00167873 predicted 974
5 SASI_Mm01_00167874 predicted 2003
6 SASI_Mm01_00167875 predicted 1088
7 SASI_Mm01_00167876 predicted 1380
8 SASI_Mm01_00167877 predicted 1136
9 SASI_Mm01_00167878 predicted 1054
10 SASI_Mm01_00167879 predicted 1018
11 SASI_Mm01_00167880 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145182 predicted 611
2 SASI_Mm01_00145183 predicted 697
3 SASI_Mm01_00145184 predicted 513
4 SASI_Mm01_00145185 predicted 449
5 SASI_Mm01_00145186 predicted 440
6 SASI_Mm01_00145187 predicted 937
7 SASI_Mm01_00145188 predicted 907
8 SASI_Mm01_00145189 predicted 992
9 SASI_Mm01_00145190 predicted 1028
10 SASI_Mm01_00145191 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084645 predicted 2153
2 SASI_Mm01_00084646 predicted 2823
3 SASI_Mm02_00351354 predicted 2946
4 SASI_Mm01_00084647 predicted 792
5 SASI_Mm01_00084648 predicted 1795
6 SASI_Mm01_00084649 predicted 880
7 SASI_Mm01_00084650 predicted 630
8 SASI_Mm01_00084651 predicted 1088
9 SASI_Mm01_00084652 predicted 1725
10 SASI_Mm01_00084654 predicted 1875
11 SASI_Mm01_00084653 predicted 1641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199080
VALIDATED
DDX17 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2716s21c1
Sequence:CCGGTAATGCATGTTGAGGATATTGCTCGAGCAATATCCTCAACATGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1725s21c1
Sequence:CCGGTTTGTCATCAACTACGATTATCTCGAGATAATCGTAGTTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2367s21c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1759s21c1
Sequence:CCGGAGGATTATGTTCACCGTATTGCTCGAGCAATACGGTGAACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-788s1c1
Sequence:CCGGCCATACTTGGAAAGAGGAGATCTCGAGATCTCCTCTTTCCAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-2186s1c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-760s1c1
Sequence:CCGGGCCTGCGATTGTTCATATAAACTCGAGTTTATATGAACAATCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-1870s1c1
Sequence:CCGGCCGGAGAGATTCTACAAGCTACTCGAGTAGCTTGTAGAATCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199080.1-4237s1c1
Sequence:CCGGGCTGGGTTAATTGCCGTTTATCTCGAGATAAACGGCAATTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199080
VALIDATED
DDX17 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2716s21c1
Sequence:CCGGTAATGCATGTTGAGGATATTGCTCGAGCAATATCCTCAACATGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1725s21c1
Sequence:CCGGTTTGTCATCAACTACGATTATCTCGAGATAATCGTAGTTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2367s21c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1759s21c1
Sequence:CCGGAGGATTATGTTCACCGTATTGCTCGAGCAATACGGTGAACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-788s1c1
Sequence:CCGGCCATACTTGGAAAGAGGAGATCTCGAGATCTCCTCTTTCCAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-2186s1c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-760s1c1
Sequence:CCGGGCCTGCGATTGTTCATATAAACTCGAGTTTATATGAACAATCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-1870s1c1
Sequence:CCGGCCGGAGAGATTCTACAAGCTACTCGAGTAGCTTGTAGAATCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199080.1-4237s1c1
Sequence:CCGGGCTGGGTTAATTGCCGTTTATCTCGAGATAAACGGCAATTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199080
VALIDATED
DDX17 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2716s21c1
Sequence:CCGGTAATGCATGTTGAGGATATTGCTCGAGCAATATCCTCAACATGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1725s21c1
Sequence:CCGGTTTGTCATCAACTACGATTATCTCGAGATAATCGTAGTTGATGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-2367s21c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_199080.2-1759s21c1
Sequence:CCGGAGGATTATGTTCACCGTATTGCTCGAGCAATACGGTGAACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-788s1c1
Sequence:CCGGCCATACTTGGAAAGAGGAGATCTCGAGATCTCCTCTTTCCAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-2186s1c1
Sequence:CCGGCCAGGAGCTACCAATATGATACTCGAGTATCATATTGGTAGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-760s1c1
Sequence:CCGGGCCTGCGATTGTTCATATAAACTCGAGTTTATATGAACAATCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_199080.1-1870s1c1
Sequence:CCGGCCGGAGAGATTCTACAAGCTACTCGAGTAGCTTGTAGAATCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199080.1-4237s1c1
Sequence:CCGGGCTGGGTTAATTGCCGTTTATCTCGAGATAAACGGCAATTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006386
VALIDATED
DDX17 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1829s21c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1202s21c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-4019s21c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1310s21c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1602s21c1
Sequence:CCGGAGGATTATGTGCACCGTATTGCTCGAGCAATACGGTGCACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-3990s1c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1173s1c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1283s1c1
Sequence:CCGGCCACAAGTTGATCCAACTAATCTCGAGATTAGTTGGATCAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1281s1c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1800s1c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006386
VALIDATED
DDX17 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1829s21c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1202s21c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-4019s21c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1310s21c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1602s21c1
Sequence:CCGGAGGATTATGTGCACCGTATTGCTCGAGCAATACGGTGCACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-3990s1c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1173s1c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1283s1c1
Sequence:CCGGCCACAAGTTGATCCAACTAATCTCGAGATTAGTTGGATCAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1281s1c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1800s1c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006386
VALIDATED
DDX17 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1829s21c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1202s21c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-4019s21c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1310s21c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006386.4-1602s21c1
Sequence:CCGGAGGATTATGTGCACCGTATTGCTCGAGCAATACGGTGCACATAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-3990s1c1
Sequence:CCGGGCACAGAAGAAACATGGCAAACTCGAGTTTGCCATGTTTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1173s1c1
Sequence:CCGGGCAGAGGATTTCCTTCGTGATCTCGAGATCACGAAGGAAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1283s1c1
Sequence:CCGGCCACAAGTTGATCCAACTAATCTCGAGATTAGTTGGATCAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1281s1c1
Sequence:CCGGGACCACAAGTTGATCCAACTACTCGAGTAGTTGGATCAACTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006386.3-1800s1c1
Sequence:CCGGCCCAATCTGATGTATCAGGATCTCGAGATCCTGATACATCAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks