EMAIL THIS PAGE TO A FRIEND

DDX18

DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

56 Gene Product Result for
Synonyms: MrDb
UniProtKB ID: Q9NVP1, Q6GTZ9, Q6IAU4, Q92732, Q9BQB7
Gene ID:
Human(8886) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Mouse(66942) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Rat(308490) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
domestic guinea pig(100735235) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
naked mole-rat(101713381) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
sheep(101110033) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Domestic Rabbit(100328887) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Zebrafish(321127) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
chicken(424278) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
domestic cat(101084384) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
cow(519254) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
cow(782091) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Horse(100147601) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
dog(476120) DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006773 Rosetta Predictions human pricing
NM_001006996 Rosetta Predictions rat pricing
NM_025860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056883 predicted 1241
2 SASI_Hs01_00056884 predicted 840
3 SASI_Hs01_00056885 predicted 1862
4 SASI_Hs01_00056886 predicted 1300
5 SASI_Hs01_00056887 predicted 1652
6 SASI_Hs01_00056888 predicted 933
7 SASI_Hs01_00056889 predicted 983
8 SASI_Hs01_00056890 predicted 1730
9 SASI_Hs01_00056891 predicted 1518
10 SASI_Hs01_00056892 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198578 predicted 841
2 SASI_Rn01_00035301 predicted 1346
3 SASI_Rn01_00035302 predicted 1864
4 SASI_Rn01_00035303 predicted 1190
5 SASI_Rn01_00035304 predicted 1700
6 SASI_Rn01_00035306 predicted 1429
7 SASI_Rn01_00035307 predicted 624
8 SASI_Rn01_00035308 predicted 750
9 SASI_Rn01_00035309 predicted 852
10 SASI_Rn02_00198579 predicted 1459
11 SASI_Rn01_00035305 predicted 810
12 SASI_Rn01_00035310 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091397 predicted 1185
2 SASI_Mm01_00091398 predicted 1676
3 SASI_Mm02_00329166 predicted 1336
4 SASI_Mm01_00091399 predicted 1344
5 SASI_Mm01_00091400 predicted 1258
6 SASI_Mm01_00091402 predicted 1366
7 SASI_Mm02_00329167 predicted 1251
8 SASI_Mm01_00091394 predicted 993
9 SASI_Mm02_00329168 predicted 1709
10 SASI_Mm02_00329169 predicted 1197
11 SASI_Mm01_00091395 predicted 1837
12 SASI_Mm01_00091396 predicted 1074
13 SASI_Mm01_00091401 predicted 807
14 SASI_Mm01_00091403 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025860
VALIDATED
DDX18 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-601s1c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1707s1c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1049s1c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1640s1c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025860.2-143s1c1
Sequence:CCGGCGAAACCTGAAGCTGCAAGAACTCGAGTTCTTGCAGCTTCAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025860.2-1640s21c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-601s21c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1049s21c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1707s21c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025860
VALIDATED
DDX18 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-601s1c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1707s1c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1049s1c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1640s1c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025860.2-143s1c1
Sequence:CCGGCGAAACCTGAAGCTGCAAGAACTCGAGTTCTTGCAGCTTCAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025860.2-1640s21c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-601s21c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1049s21c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1707s21c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025860
VALIDATED
DDX18 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-601s1c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1707s1c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1049s1c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025860.2-1640s1c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025860.2-143s1c1
Sequence:CCGGCGAAACCTGAAGCTGCAAGAACTCGAGTTCTTGCAGCTTCAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025860.2-1640s21c1
Sequence:CCGGCCTGAAGAGTTGGGTTTCCTTCTCGAGAAGGAAACCCAACTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-601s21c1
Sequence:CCGGCGTCAATGAGAACACCCTGAACTCGAGTTCAGGGTGTTCTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1049s21c1
Sequence:CCGGGCTGACCGTATCTTGGATGTTCTCGAGAACATCCAAGATACGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025860.2-1707s21c1
Sequence:CCGGCCTGGTCTAAAGTTTCTGATACTCGAGTATCAGAAACTTTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006773
VALIDATED
DDX18 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1161s1c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1730s1c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1344s1c1
Sequence:CCGGGCTCTTTACATTCCTTAAGAACTCGAGTTCTTAAGGAATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1218s1c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-933s1c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-933s21c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1161s21c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1218s21c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1730s21c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006773
VALIDATED
DDX18 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1161s1c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1730s1c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1344s1c1
Sequence:CCGGGCTCTTTACATTCCTTAAGAACTCGAGTTCTTAAGGAATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1218s1c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-933s1c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-933s21c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1161s21c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1218s21c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1730s21c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006773
VALIDATED
DDX18 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1161s1c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1730s1c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006773.3-1344s1c1
Sequence:CCGGGCTCTTTACATTCCTTAAGAACTCGAGTTCTTAAGGAATGTAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-1218s1c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006773.3-933s1c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-933s21c1
Sequence:CCGGCGTGCATACCTATGGCTTGATCTCGAGATCAAGCCATAGGTATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1161s21c1
Sequence:CCGGGCCAACACGTAGACAGACTATCTCGAGATAGTCTGTCTACGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1218s21c1
Sequence:CCGGCCTGGCAAGGATTTCTCTGAACTCGAGTTCAGAGAAATCCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006773.3-1730s21c1
Sequence:CCGGCCAAGGTTCCATTAAGTGAATCTCGAGATTCACTTAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks