EMAIL THIS PAGE TO A FRIEND

DDX19A

DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A

92 Gene Product Result for
Synonyms: DDX19-DDX19L DDX19L
UniProtKB ID: Q9NUU7, B2RPL0, Q53FM0
Gene ID:
Mouse(13680) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Rat(292022) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
dog(479658) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
cow(529929) DEAD (Asp-Glu-Ala-As) box polypeptide 19A
domestic cat(101087286) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Domestic Rabbit(100339723) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
naked mole-rat(101721083) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
domestic guinea pig(100720073) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018332 Rosetta Predictions human pricing
NM_001005381 Rosetta Predictions rat pricing
XM_001077485 Rosetta Predictions rat pricing
NM_007916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106676 predicted 399
2 SASI_Hs01_00106677 predicted 607
3 SASI_Hs01_00106678 predicted 570
4 SASI_Hs01_00106679 predicted 427
5 SASI_Hs01_00106680 predicted 393
6 SASI_Hs01_00106682 predicted 608
7 SASI_Hs01_00106683 predicted 462
8 SASI_Hs01_00106684 predicted 467
9 SASI_Hs01_00106681 predicted 628
10 SASI_Hs01_00106685 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105843 predicted 1258
2 SASI_Rn02_00198362 predicted 574
3 SASI_Rn02_00198363 predicted 628
4 SASI_Rn02_00198364 predicted 390
5 SASI_Rn02_00198365 predicted 129
6 SASI_Rn02_00198366 predicted 122
7 SASI_Rn01_00105844 predicted 650
8 SASI_Rn01_00105845 predicted 268
9 SASI_Rn01_00105846 predicted 1254
10 SASI_Rn01_00105847 predicted 604
11 SASI_Rn01_00105848 predicted 1466
12 SASI_Rn01_00105849 predicted 983
13 SASI_Rn01_00105850 predicted 1259
14 SASI_Rn01_00105851 predicted 1504
15 SASI_Rn01_00105852 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357225 predicted 685
2 SASI_Rn02_00357226 predicted 1268
3 SASI_Rn02_00357227 predicted 1358
4 SASI_Rn02_00357228 predicted 306
5 SASI_Rn02_00357229 predicted 1252
6 SASI_Rn02_00357230 predicted 1470
7 SASI_Rn02_00357231 predicted 217
8 SASI_Rn02_00357232 predicted 1248
9 SASI_Rn02_00357233 predicted 1495
10 SASI_Rn02_00357234 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133970 predicted 608
2 SASI_Mm01_00133971 predicted 646
3 SASI_Mm01_00133972 predicted 409
4 SASI_Mm01_00133973 predicted 596
5 SASI_Mm01_00133974 predicted 427
6 SASI_Mm01_00133975 predicted 664
7 SASI_Mm01_00133976 predicted 493
8 SASI_Mm01_00133977 predicted 659
9 SASI_Mm01_00133978 predicted 534
10 SASI_Mm02_00312728 predicted 189
11 SASI_Mm01_00133979 predicted 165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007916
VALIDATED
DDX19A MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-417s21c1
Sequence:CCGGTCTACGCCATGGGCTTCAATCCTCGAGGATTGAAGCCCATGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-194s21c1
Sequence:CCGGGCAGACACCAATGGTGTTATCCTCGAGGATAACACCATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007916.2-563s21c1
Sequence:CCGGGTGGAACCAGCAGACAGATATCTCGAGATATCTGTCTGCTGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-2019s21c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-149s21c1
Sequence:CCGGGTCAAGTCGATGAGCAGTTTGCTCGAGCAAACTGCTCATCGACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-2011s1c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-601s1c1
Sequence:CCGGCCCAACATATGAGCTGGCATTCTCGAGAATGCCAGCTCATATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-612s1c1
Sequence:CCGGAGCTGGCATTACAAACTGGAACTCGAGTTCCAGTTTGTAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-181s1c1
Sequence:CCGGGAAAGCAAAGTCAGACACCAACTCGAGTTGGTGTCTGACTTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-791s1c1
Sequence:CCGGCCCAAGAAGATCAAGGTGTTTCTCGAGAAACACCTTGATCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007916
VALIDATED
DDX19A MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-417s21c1
Sequence:CCGGTCTACGCCATGGGCTTCAATCCTCGAGGATTGAAGCCCATGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-194s21c1
Sequence:CCGGGCAGACACCAATGGTGTTATCCTCGAGGATAACACCATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007916.2-563s21c1
Sequence:CCGGGTGGAACCAGCAGACAGATATCTCGAGATATCTGTCTGCTGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-2019s21c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-149s21c1
Sequence:CCGGGTCAAGTCGATGAGCAGTTTGCTCGAGCAAACTGCTCATCGACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-2011s1c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-601s1c1
Sequence:CCGGCCCAACATATGAGCTGGCATTCTCGAGAATGCCAGCTCATATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-612s1c1
Sequence:CCGGAGCTGGCATTACAAACTGGAACTCGAGTTCCAGTTTGTAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-181s1c1
Sequence:CCGGGAAAGCAAAGTCAGACACCAACTCGAGTTGGTGTCTGACTTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-791s1c1
Sequence:CCGGCCCAAGAAGATCAAGGTGTTTCTCGAGAAACACCTTGATCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007916
VALIDATED
DDX19A MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-417s21c1
Sequence:CCGGTCTACGCCATGGGCTTCAATCCTCGAGGATTGAAGCCCATGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-194s21c1
Sequence:CCGGGCAGACACCAATGGTGTTATCCTCGAGGATAACACCATTGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007916.2-563s21c1
Sequence:CCGGGTGGAACCAGCAGACAGATATCTCGAGATATCTGTCTGCTGGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-2019s21c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007916.2-149s21c1
Sequence:CCGGGTCAAGTCGATGAGCAGTTTGCTCGAGCAAACTGCTCATCGACTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-2011s1c1
Sequence:CCGGCCTTGAATAAATGAGAGGAAACTCGAGTTTCCTCTCATTTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-601s1c1
Sequence:CCGGCCCAACATATGAGCTGGCATTCTCGAGAATGCCAGCTCATATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-612s1c1
Sequence:CCGGAGCTGGCATTACAAACTGGAACTCGAGTTCCAGTTTGTAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007916.1-181s1c1
Sequence:CCGGGAAAGCAAAGTCAGACACCAACTCGAGTTGGTGTCTGACTTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007916.1-791s1c1
Sequence:CCGGCCCAAGAAGATCAAGGTGTTTCTCGAGAAACACCTTGATCTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018332
VALIDATED
DDX19A MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2384s21c1
Sequence:GTACCGGGTTATGACCAAGGGAATTATGCTCGAGCATAATTCCCTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2148s21c1
Sequence:GTACCGGAGAAACACGAAAGTCTGAATCCTCGAGGATTCAGACTTTCGTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-581s21c1
Sequence:CCGGATATGAGCTGGCGCTTCAAACCTCGAGGTTTGAAGCGCCAGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-165s21c1
Sequence:CCGGGCAGATACCAATGGTATTATCCTCGAGGATAATACCATTGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-121s21c1
Sequence:CCGGTCAAGTCGATGACCAATTTGCCTCGAGGCAAATTGGTCATCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-117s1c1
Sequence:CCGGGCTGTCAAGTCGATGACCAATCTCGAGATTGGTCATCGACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-636s1c1
Sequence:CCGGCCAGAACTGAAGCTTGCCTATCTCGAGATAGGCAAGCTTCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-128s1c1
Sequence:CCGGGATGACCAATTTGCAGATCAACTCGAGTTGATCTGCAAATTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-941s1c1
Sequence:CCGGCCCAAATGTTATCAAACTGAACTCGAGTTCAGTTTGATAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-1251s1c1
Sequence:CCGGCGCGGCATTGATGTTGAACAACTCGAGTTGTTCAACATCAATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018332
VALIDATED
DDX19A MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2384s21c1
Sequence:GTACCGGGTTATGACCAAGGGAATTATGCTCGAGCATAATTCCCTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2148s21c1
Sequence:GTACCGGAGAAACACGAAAGTCTGAATCCTCGAGGATTCAGACTTTCGTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-581s21c1
Sequence:CCGGATATGAGCTGGCGCTTCAAACCTCGAGGTTTGAAGCGCCAGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-165s21c1
Sequence:CCGGGCAGATACCAATGGTATTATCCTCGAGGATAATACCATTGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-121s21c1
Sequence:CCGGTCAAGTCGATGACCAATTTGCCTCGAGGCAAATTGGTCATCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-117s1c1
Sequence:CCGGGCTGTCAAGTCGATGACCAATCTCGAGATTGGTCATCGACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-636s1c1
Sequence:CCGGCCAGAACTGAAGCTTGCCTATCTCGAGATAGGCAAGCTTCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-128s1c1
Sequence:CCGGGATGACCAATTTGCAGATCAACTCGAGTTGATCTGCAAATTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-941s1c1
Sequence:CCGGCCCAAATGTTATCAAACTGAACTCGAGTTCAGTTTGATAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-1251s1c1
Sequence:CCGGCGCGGCATTGATGTTGAACAACTCGAGTTGTTCAACATCAATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018332
VALIDATED
DDX19A MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2384s21c1
Sequence:GTACCGGGTTATGACCAAGGGAATTATGCTCGAGCATAATTCCCTTGGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-2148s21c1
Sequence:GTACCGGAGAAACACGAAAGTCTGAATCCTCGAGGATTCAGACTTTCGTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-581s21c1
Sequence:CCGGATATGAGCTGGCGCTTCAAACCTCGAGGTTTGAAGCGCCAGCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-165s21c1
Sequence:CCGGGCAGATACCAATGGTATTATCCTCGAGGATAATACCATTGGTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018332.3-121s21c1
Sequence:CCGGTCAAGTCGATGACCAATTTGCCTCGAGGCAAATTGGTCATCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-117s1c1
Sequence:CCGGGCTGTCAAGTCGATGACCAATCTCGAGATTGGTCATCGACTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-636s1c1
Sequence:CCGGCCAGAACTGAAGCTTGCCTATCTCGAGATAGGCAAGCTTCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-128s1c1
Sequence:CCGGGATGACCAATTTGCAGATCAACTCGAGTTGATCTGCAAATTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-941s1c1
Sequence:CCGGCCCAAATGTTATCAAACTGAACTCGAGTTCAGTTTGATAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018332.3-1251s1c1
Sequence:CCGGCGCGGCATTGATGTTGAACAACTCGAGTTGTTCAACATCAATGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks