EMAIL THIS PAGE TO A FRIEND

DDX19B

DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B

94 Gene Product Result for
Synonyms: DBP5 DDX19 RNAh
Gene ID:
Human(11269) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(234733) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Rat(690693) DEAD (Asp-Glu-Ala-As) box polypeptide 19B
domestic guinea pig(100719332) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
naked mole-rat(101720257) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
sheep(101115151) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
chicken(426504) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
domestic cat(101087696) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Horse(100068576) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Horse(100054938) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
cow(517438) DEAD (Asp-Glu-Ala-As) box polypeptide 19B
dog(479657) DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007242 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094361 MISSION® esiRNA esiRNA targeting mouse Ddx19b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014449 Rosetta Predictions human pricing
NM_001014451 Rosetta Predictions human pricing
NM_007242 Rosetta Predictions human pricing
XM_001075251 Rosetta Predictions rat pricing
NM_172284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186927 predicted 417
2 SASI_Hs01_00186928 predicted 566
3 SASI_Hs01_00186929 predicted 353
4 SASI_Hs01_00186930 predicted 585
5 SASI_Hs01_00186931 predicted 531
6 SASI_Hs01_00186932 predicted 350
7 SASI_Hs01_00186934 predicted 485
8 SASI_Hs01_00186935 predicted 530
9 SASI_Hs02_00306559 predicted 596
10 SASI_Hs02_00306560 predicted 564
11 SASI_Hs01_00186933 predicted 365
12 SASI_Hs01_00186936 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160695 predicted 574
2 SASI_Hs01_00160696 predicted 596
3 SASI_Hs01_00160697 predicted 542
4 SASI_Hs01_00160698 predicted 492
5 SASI_Hs01_00160699 predicted 182
6 SASI_Hs01_00160700 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137002 predicted 662
2 SASI_Hs01_00137003 predicted 452
3 SASI_Hs01_00137004 predicted 694
4 SASI_Hs01_00137005 predicted 633
5 SASI_Hs01_00137006 predicted 456
6 SASI_Hs01_00137008 predicted 589
7 SASI_Hs01_00137009 predicted 189
8 SASI_Hs01_00137010 predicted 236
9 SASI_Hs01_00137007 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348982 predicted 1901
2 SASI_Rn02_00348983 predicted 494
3 SASI_Rn02_00348984 predicted 619
4 SASI_Rn02_00348985 predicted 172
5 SASI_Rn02_00348986 predicted 215
6 SASI_Rn02_00348987 predicted 438
7 SASI_Rn02_00348988 predicted 437
8 SASI_Rn02_00348989 predicted 164
9 SASI_Rn02_00348990 predicted 116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067943 predicted 433
2 SASI_Mm01_00067944 predicted 499
3 SASI_Mm01_00067945 predicted 617
4 SASI_Mm01_00067946 predicted 615
5 SASI_Mm01_00067947 predicted 217
6 SASI_Mm01_00067948 predicted 576
7 SASI_Mm01_00067949 predicted 438
8 SASI_Mm01_00067950 predicted 674
9 SASI_Mm01_00067951 predicted 616
10 SASI_Mm01_00067952 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172284
DDX19B MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172284.1-2045s1c1
Sequence:CCGGGCTGACATTCTTTCCAGGAAACTCGAGTTTCCTGGAAAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-584s1c1
Sequence:CCGGCCAACCTATGAGCTTGCTCTTCTCGAGAAGAGCAAGCTCATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-185s1c1
Sequence:CCGGGCTGTTGTTAAGACCAATGCACTCGAGTGCATTGGTCTTAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-187s1c1
Sequence:CCGGTGTTGTTAAGACCAATGCAAACTCGAGTTTGCATTGGTCTTAACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-390s1c1
Sequence:CCGGAGGGAGTCTATGCTATGGGTTCTCGAGAACCCATAGCATAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172284
DDX19B MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172284.1-2045s1c1
Sequence:CCGGGCTGACATTCTTTCCAGGAAACTCGAGTTTCCTGGAAAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-584s1c1
Sequence:CCGGCCAACCTATGAGCTTGCTCTTCTCGAGAAGAGCAAGCTCATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-185s1c1
Sequence:CCGGGCTGTTGTTAAGACCAATGCACTCGAGTGCATTGGTCTTAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-187s1c1
Sequence:CCGGTGTTGTTAAGACCAATGCAAACTCGAGTTTGCATTGGTCTTAACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-390s1c1
Sequence:CCGGAGGGAGTCTATGCTATGGGTTCTCGAGAACCCATAGCATAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172284
DDX19B MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172284.1-2045s1c1
Sequence:CCGGGCTGACATTCTTTCCAGGAAACTCGAGTTTCCTGGAAAGAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-584s1c1
Sequence:CCGGCCAACCTATGAGCTTGCTCTTCTCGAGAAGAGCAAGCTCATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-185s1c1
Sequence:CCGGGCTGTTGTTAAGACCAATGCACTCGAGTGCATTGGTCTTAACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-187s1c1
Sequence:CCGGTGTTGTTAAGACCAATGCAAACTCGAGTTTGCATTGGTCTTAACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172284.1-390s1c1
Sequence:CCGGAGGGAGTCTATGCTATGGGTTCTCGAGAACCCATAGCATAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007242
VALIDATED
DDX19B MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-554s1c1
Sequence:CCGGGCCATGCTTAGCCAAGTAGAACTCGAGTTCTACTTGGCTAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-236s1c1
Sequence:CCGGGCAGAGAAGACAGATGAAGAACTCGAGTTCTTCATCTGTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-671s1c1
Sequence:CCGGCCTGAACTGAAGCTAGCTTATCTCGAGATAAGCTAGCTTCAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-495s1c1
Sequence:CCGGCACAGAACTTAATTGCCCAATCTCGAGATTGGGCAATTAAGTTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-159s1c1
Sequence:CCGGCGTTGAGCAACTTGCATCTTACTCGAGTAAGATGCAAGTTGCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-491s21c1
Sequence:CCGGACGCATTGCCACTGATGCTTGCTCGAGCAAGCATCAGTGGCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-456s21c1
Sequence:CCGGCATGGGTTTCAATCGTCCATCCTCGAGGATGGACGATTGAAACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-643s21c1
Sequence:CCGGTATGAGCTCGCCCTCCAAACACTCGAGTGTTTGGAGGGCGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-225s21c1
Sequence:CCGGAGATACCAATGGTGCTGTTGTCTCGAGACAACAGCACCATTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-236s21c1
Sequence:CCGGGTGCTGTTGTCAAGACCAATGCTCGAGCATTGGTCTTGACAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-589s21c1
Sequence:CCGGAGCCAAGTAGAACCTGCAAACCTCGAGGTTTGCAGGTTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-186s21c1
Sequence:CCGGGTTGAGCAACTTGCATCTTAACTCGAGTTAAGATGCAAGTTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-698s21c1
Sequence:CCGGCTGAACTGAAGCTAGCTTATGCTCGAGCATAAGCTAGCTTCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007242.4-1613s21c1
Sequence:CCGGCACAGGAGACAAGTGCGTTCACTCGAGTGAACGCACTTGTCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007242
VALIDATED
DDX19B MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-554s1c1
Sequence:CCGGGCCATGCTTAGCCAAGTAGAACTCGAGTTCTACTTGGCTAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-236s1c1
Sequence:CCGGGCAGAGAAGACAGATGAAGAACTCGAGTTCTTCATCTGTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-671s1c1
Sequence:CCGGCCTGAACTGAAGCTAGCTTATCTCGAGATAAGCTAGCTTCAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-495s1c1
Sequence:CCGGCACAGAACTTAATTGCCCAATCTCGAGATTGGGCAATTAAGTTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-159s1c1
Sequence:CCGGCGTTGAGCAACTTGCATCTTACTCGAGTAAGATGCAAGTTGCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-491s21c1
Sequence:CCGGACGCATTGCCACTGATGCTTGCTCGAGCAAGCATCAGTGGCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-456s21c1
Sequence:CCGGCATGGGTTTCAATCGTCCATCCTCGAGGATGGACGATTGAAACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-643s21c1
Sequence:CCGGTATGAGCTCGCCCTCCAAACACTCGAGTGTTTGGAGGGCGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-225s21c1
Sequence:CCGGAGATACCAATGGTGCTGTTGTCTCGAGACAACAGCACCATTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-236s21c1
Sequence:CCGGGTGCTGTTGTCAAGACCAATGCTCGAGCATTGGTCTTGACAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-589s21c1
Sequence:CCGGAGCCAAGTAGAACCTGCAAACCTCGAGGTTTGCAGGTTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-186s21c1
Sequence:CCGGGTTGAGCAACTTGCATCTTAACTCGAGTTAAGATGCAAGTTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-698s21c1
Sequence:CCGGCTGAACTGAAGCTAGCTTATGCTCGAGCATAAGCTAGCTTCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007242.4-1613s21c1
Sequence:CCGGCACAGGAGACAAGTGCGTTCACTCGAGTGAACGCACTTGTCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007242
VALIDATED
DDX19B MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-554s1c1
Sequence:CCGGGCCATGCTTAGCCAAGTAGAACTCGAGTTCTACTTGGCTAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-236s1c1
Sequence:CCGGGCAGAGAAGACAGATGAAGAACTCGAGTTCTTCATCTGTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-671s1c1
Sequence:CCGGCCTGAACTGAAGCTAGCTTATCTCGAGATAAGCTAGCTTCAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-495s1c1
Sequence:CCGGCACAGAACTTAATTGCCCAATCTCGAGATTGGGCAATTAAGTTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007242.3-159s1c1
Sequence:CCGGCGTTGAGCAACTTGCATCTTACTCGAGTAAGATGCAAGTTGCTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-491s21c1
Sequence:CCGGACGCATTGCCACTGATGCTTGCTCGAGCAAGCATCAGTGGCAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-456s21c1
Sequence:CCGGCATGGGTTTCAATCGTCCATCCTCGAGGATGGACGATTGAAACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-643s21c1
Sequence:CCGGTATGAGCTCGCCCTCCAAACACTCGAGTGTTTGGAGGGCGAGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-225s21c1
Sequence:CCGGAGATACCAATGGTGCTGTTGTCTCGAGACAACAGCACCATTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-236s21c1
Sequence:CCGGGTGCTGTTGTCAAGACCAATGCTCGAGCATTGGTCTTGACAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-589s21c1
Sequence:CCGGAGCCAAGTAGAACCTGCAAACCTCGAGGTTTGCAGGTTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-186s21c1
Sequence:CCGGGTTGAGCAACTTGCATCTTAACTCGAGTTAAGATGCAAGTTGCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007242.4-698s21c1
Sequence:CCGGCTGAACTGAAGCTAGCTTATGCTCGAGCATAAGCTAGCTTCAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007242.4-1613s21c1
Sequence:CCGGCACAGGAGACAAGTGCGTTCACTCGAGTGAACGCACTTGTCTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks