EMAIL THIS PAGE TO A FRIEND

DDX1

DEAD (Asp-Glu-Ala-Asp) box helicase 1

70 Gene Product Result for
Synonyms: DBP-RB UKVH5d
UniProtKB ID: Q92499
Gene ID:
Human(1653) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Mouse(104721) DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Rat(84474) DEAD (Asp-Glu-Ala-Asp) box helicase 1
Zebrafish(556790) DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
cow(510816) DEAD (Asp-Glu-Ala-Asp) box polypeptide 1
domestic cat(101093265) DEAD (Asp-Glu-Ala-Asp) box helicase 1
dog(475671) DEAD (Asp-Glu-Ala-Asp) box helicase 1
chicken(395249) DEAD (Asp-Glu-Ala-Asp) box helicase 1
fruit fly(40457) Dead-box-1
naked mole-rat(101718684) DEAD (Asp-Glu-Ala-Asp) box helicase 1
sheep(101122091) DEAD (Asp-Glu-Ala-Asp) box helicase 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004939 Rosetta Predictions human pricing
NM_053414 Rosetta Predictions rat pricing
NM_134040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119668 predicted 2085
2 SASI_Hs01_00119669 predicted 799
3 SASI_Hs01_00119670 predicted 458
4 SASI_Hs02_00338611 predicted 369
5 SASI_Hs01_00119671 predicted 1304
6 SASI_Hs01_00119673 predicted 836
7 SASI_Hs02_00338612 predicted 1339
8 SASI_Hs01_00119674 predicted 763
9 SASI_Hs01_00119675 predicted 394
10 SASI_Hs01_00119676 predicted 1559
11 SASI_Hs01_00119672 predicted 2390
12 SASI_Hs01_00119677 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105503 predicted 689
2 SASI_Rn01_00105504 predicted 1596
3 SASI_Rn02_00265937 predicted 1356
4 SASI_Rn01_00105505 predicted 212
5 SASI_Rn01_00105506 predicted 1061
6 SASI_Rn01_00105507 predicted 1732
7 SASI_Rn01_00105509 predicted 1149
8 SASI_Rn01_00105511 predicted 860
9 SASI_Rn01_00105512 predicted 1953
10 SASI_Rn02_00265938 predicted 600
11 SASI_Rn01_00105508 predicted 1190
12 SASI_Rn01_00105510 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200930 predicted 525
2 SASI_Mm02_00339204 predicted 1831
3 SASI_Mm01_00200931 predicted 697
4 SASI_Mm01_00200932 predicted 609
5 SASI_Mm01_00200933 predicted 787
6 SASI_Mm01_00200934 predicted 224
7 SASI_Mm01_00200935 predicted 419
8 SASI_Mm01_00200936 predicted 211
9 SASI_Mm01_00200937 predicted 1367
10 SASI_Mm01_00200938 predicted 1674
11 SASI_Mm01_00200939 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134040
VALIDATED
DDX1 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2290s21c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1504s21c1
Sequence:CCGGGATGTGGTCTGAAGCTATTAACTCGAGTTAATAGCTTCAGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1218s21c1
Sequence:CCGGACAACCAGATTCCGCAGATTACTCGAGTAATCTGCGGAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2067s21c1
Sequence:CCGGCCCAGGTCGAGCCAGATATAACTCGAGTTATATCTGGCTCGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1954s21c1
Sequence:CCGGCCGTGGGAAGGGATGCTATAACTCGAGTTATAGCATCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134040.1-2290s1c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-627s1c1
Sequence:CCGGCCATTGGATGTTACTTAGATACTCGAGTATCTAAGTAACATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-664s1c1
Sequence:CCGGGAAGTTCTCTAAGAATGGAAACTCGAGTTTCCATTCTTAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-838s1c1
Sequence:CCGGCCCAGATAATTACATCGTCAACTCGAGTTGACGATGTAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-139s1c1
Sequence:CCGGCCAGGCAGAATCTATCCCATTCTCGAGAATGGGATAGATTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134040
VALIDATED
DDX1 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2290s21c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1504s21c1
Sequence:CCGGGATGTGGTCTGAAGCTATTAACTCGAGTTAATAGCTTCAGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1218s21c1
Sequence:CCGGACAACCAGATTCCGCAGATTACTCGAGTAATCTGCGGAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2067s21c1
Sequence:CCGGCCCAGGTCGAGCCAGATATAACTCGAGTTATATCTGGCTCGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1954s21c1
Sequence:CCGGCCGTGGGAAGGGATGCTATAACTCGAGTTATAGCATCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134040.1-2290s1c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-627s1c1
Sequence:CCGGCCATTGGATGTTACTTAGATACTCGAGTATCTAAGTAACATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-664s1c1
Sequence:CCGGGAAGTTCTCTAAGAATGGAAACTCGAGTTTCCATTCTTAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-838s1c1
Sequence:CCGGCCCAGATAATTACATCGTCAACTCGAGTTGACGATGTAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-139s1c1
Sequence:CCGGCCAGGCAGAATCTATCCCATTCTCGAGAATGGGATAGATTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134040
VALIDATED
DDX1 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2290s21c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1504s21c1
Sequence:CCGGGATGTGGTCTGAAGCTATTAACTCGAGTTAATAGCTTCAGACCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1218s21c1
Sequence:CCGGACAACCAGATTCCGCAGATTACTCGAGTAATCTGCGGAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-2067s21c1
Sequence:CCGGCCCAGGTCGAGCCAGATATAACTCGAGTTATATCTGGCTCGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134040.1-1954s21c1
Sequence:CCGGCCGTGGGAAGGGATGCTATAACTCGAGTTATAGCATCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134040.1-2290s1c1
Sequence:CCGGCAGAGGAGCATTGGAGTCATACTCGAGTATGACTCCAATGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-627s1c1
Sequence:CCGGCCATTGGATGTTACTTAGATACTCGAGTATCTAAGTAACATCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-664s1c1
Sequence:CCGGGAAGTTCTCTAAGAATGGAAACTCGAGTTTCCATTCTTAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-838s1c1
Sequence:CCGGCCCAGATAATTACATCGTCAACTCGAGTTGACGATGTAATTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134040.1-139s1c1
Sequence:CCGGCCAGGCAGAATCTATCCCATTCTCGAGAATGGGATAGATTCTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004939
VALIDATED
DDX1 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1072s21c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1782s21c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-645s21c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-372s21c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-372s1c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-1782s1c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-645s1c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004939.1-1072s1c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-463s1c1
Sequence:CCGGCCAGTTATCCAGATAGTTTATCTCGAGATAAACTATCTGGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004939
VALIDATED
DDX1 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1072s21c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1782s21c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-645s21c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-372s21c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-372s1c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-1782s1c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-645s1c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004939.1-1072s1c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-463s1c1
Sequence:CCGGCCAGTTATCCAGATAGTTTATCTCGAGATAAACTATCTGGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004939
VALIDATED
DDX1 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1072s21c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-1782s21c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-645s21c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004939.1-372s21c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-372s1c1
Sequence:CCGGCCAGGCTGAATCTATCCCATTCTCGAGAATGGGATAGATTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-1782s1c1
Sequence:CCGGCCGGGCAATCAAGGAACATAACTCGAGTTATGTTCCTTGATTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-645s1c1
Sequence:CCGGGCATGGGTGTAGAGCTACTAACTCGAGTTAGTAGCTCTACACCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004939.1-1072s1c1
Sequence:CCGGCCGGATGGTTACATTGTCAAACTCGAGTTTGACAATGTAACCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004939.1-463s1c1
Sequence:CCGGCCAGTTATCCAGATAGTTTATCTCGAGATAAACTATCTGGATAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks