EMAIL THIS PAGE TO A FRIEND

DDX20

DEAD (Asp-Glu-Ala-Asp) box polypeptide 20

71 Gene Product Result for
Synonyms: DP103 GEMIN3
UniProtKB ID: Q9UHI6, Q96F72, Q9NVM3, Q9UF59, Q9UIY0, Q9Y659
Gene ID:
Human(11218) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
Mouse(53975) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Rat(84473) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Zebrafish(556273) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
chicken(419869) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
cow(528433) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Horse(100063604) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
domestic cat(101097263) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
dog(475859) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
sheep(101115665) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Domestic Rabbit(100350830) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
naked mole-rat(101699950) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
domestic guinea pig(100725699) DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007204 Rosetta Predictions human pricing
XM_001066705 Rosetta Predictions rat pricing
XM_227558 Rosetta Predictions rat pricing
NM_017397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081899 predicted 761
2 SASI_Hs01_00081900 predicted 2204
3 SASI_Hs01_00081901 predicted 1797
4 SASI_Hs01_00081902 predicted 1248
5 SASI_Hs01_00081903 predicted 1689
6 SASI_Hs01_00081905 predicted 1655
7 SASI_Hs01_00081906 predicted 2371
8 SASI_Hs02_00343186 predicted 2300
9 SASI_Hs01_00081907 predicted 609
10 SASI_Hs01_00081908 predicted 2552
11 SASI_Hs01_00081904 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318503 predicted 613
2 SASI_Rn02_00318504 predicted 1312
3 SASI_Rn02_00318505 predicted 1294
4 SASI_Rn02_00318506 predicted 2327
5 SASI_Rn02_00318507 predicted 971
6 SASI_Rn02_00318508 predicted 585
7 SASI_Rn02_00318509 predicted 896
8 SASI_Rn02_00318510 predicted 2311
9 SASI_Rn02_00318511 predicted 866
10 SASI_Rn02_00318512 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384492 predicted 616
2 SASI_Rn02_00384493 predicted 1308
3 SASI_Rn02_00384494 predicted 1296
4 SASI_Rn02_00384495 predicted 2326
5 SASI_Rn02_00384496 predicted 972
6 SASI_Rn02_00384497 predicted 580
7 SASI_Rn02_00384498 predicted 894
8 SASI_Rn02_00384499 predicted 2317
9 SASI_Rn02_00384500 predicted 868
10 SASI_Rn02_00384501 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188668 predicted 1304
2 SASI_Mm01_00188669 predicted 1174
3 SASI_Mm02_00323898 predicted 1504
4 SASI_Mm01_00188670 predicted 1929
5 SASI_Mm01_00188671 predicted 543
6 SASI_Mm01_00188672 predicted 981
7 SASI_Mm02_00323899 predicted 2326
8 SASI_Mm02_00323900 predicted 566
9 SASI_Mm02_00323901 predicted 912
10 SASI_Mm01_00188673 predicted 899
11 SASI_Mm01_00188674 predicted 1322
12 SASI_Mm01_00188675 predicted 2342
13 SASI_Mm01_00188676 predicted 2648
14 SASI_Mm01_00188677 predicted 2478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017397
DDX20 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-1189s21c1
Sequence:CCGGCGCCTTGATGCTATGGCTAAACTCGAGTTTAGCCATAGCATCAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-702s21c1
Sequence:CCGGTGGATCTCCTGGTAGAATTAACTCGAGTTAATTCTACCAGGAGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-980s21c1
Sequence:CCGGAGTACTACCAAGTTGTCAATTCTCGAGAATTGACAACTTGGTAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017397.2-2737s1c1
Sequence:CCGGGCTTTCTACTGGGACACAATTCTCGAGAATTGTGTCCCAGTAGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-901s1c1
Sequence:CCGGGCTAATGCTTTGACAAGGTATCTCGAGATACCTTGTCAAAGCATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-2036s1c1
Sequence:CCGGGCTTTGTGAGAAATAGAGTTTCTCGAGAAACTCTATTTCTCACAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-1924s1c1
Sequence:CCGGGCAGAACTGGTAGACGATTATCTCGAGATAATCGTCTACCAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-562s1c1
Sequence:CCGGCCCACAAGAGAAATTGCTGTTCTCGAGAACAGCAATTTCTCTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017397
DDX20 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-1189s21c1
Sequence:CCGGCGCCTTGATGCTATGGCTAAACTCGAGTTTAGCCATAGCATCAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-702s21c1
Sequence:CCGGTGGATCTCCTGGTAGAATTAACTCGAGTTAATTCTACCAGGAGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-980s21c1
Sequence:CCGGAGTACTACCAAGTTGTCAATTCTCGAGAATTGACAACTTGGTAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017397.2-2737s1c1
Sequence:CCGGGCTTTCTACTGGGACACAATTCTCGAGAATTGTGTCCCAGTAGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-901s1c1
Sequence:CCGGGCTAATGCTTTGACAAGGTATCTCGAGATACCTTGTCAAAGCATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-2036s1c1
Sequence:CCGGGCTTTGTGAGAAATAGAGTTTCTCGAGAAACTCTATTTCTCACAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-1924s1c1
Sequence:CCGGGCAGAACTGGTAGACGATTATCTCGAGATAATCGTCTACCAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-562s1c1
Sequence:CCGGCCCACAAGAGAAATTGCTGTTCTCGAGAACAGCAATTTCTCTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017397
DDX20 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-1189s21c1
Sequence:CCGGCGCCTTGATGCTATGGCTAAACTCGAGTTTAGCCATAGCATCAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-702s21c1
Sequence:CCGGTGGATCTCCTGGTAGAATTAACTCGAGTTAATTCTACCAGGAGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017397.3-980s21c1
Sequence:CCGGAGTACTACCAAGTTGTCAATTCTCGAGAATTGACAACTTGGTAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017397.2-2737s1c1
Sequence:CCGGGCTTTCTACTGGGACACAATTCTCGAGAATTGTGTCCCAGTAGAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-901s1c1
Sequence:CCGGGCTAATGCTTTGACAAGGTATCTCGAGATACCTTGTCAAAGCATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-2036s1c1
Sequence:CCGGGCTTTGTGAGAAATAGAGTTTCTCGAGAAACTCTATTTCTCACAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-1924s1c1
Sequence:CCGGGCAGAACTGGTAGACGATTATCTCGAGATAATCGTCTACCAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017397.2-562s1c1
Sequence:CCGGCCCACAAGAGAAATTGCTGTTCTCGAGAACAGCAATTTCTCTTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007204
VALIDATED
DDX20 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2068s21c1
Sequence:CCGGCTGAATTGGTAGAGGATTATGCTCGAGCATAATCCTCTACCAATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007204.3-2761s21c1
Sequence:CCGGACCAGTGATTATAGGATATACCTCGAGGTATATCCTATAATCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2822s21c1
Sequence:CCGGTATCCATCCTCCTCGACTTATCTCGAGATAAGTCGAGGAGGATGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2355s21c1
Sequence:CCGGACGCCTGTGGATGATCGTATTCTCGAGAATACGATCATCCACAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-1020s21c1
Sequence:CCGGTCAGCTACTTATCCCGAATTTCTCGAGAAATTCGGGATAAGTAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-2662s1c1
Sequence:CCGGCCGCTTCTCATTCATATTATTCTCGAGAATAATATGAATGAGAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-2356s1c1
Sequence:CCGGCGCCTGTGGATGATCGTATTTCTCGAGAAATACGATCATCCACAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-1124s1c1
Sequence:CCGGGCAGTATTACAAAGTTGTCAACTCGAGTTGACAACTTTGTAATACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-909s1c1
Sequence:CCGGCGCCTCTTTATTCTTGATGAACTCGAGTTCATCAAGAATAAAGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007204.3-3076s1c1
Sequence:CCGGGATGACATATACCACCACTTACTCGAGTAAGTGGTGGTATATGTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007204
VALIDATED
DDX20 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2068s21c1
Sequence:CCGGCTGAATTGGTAGAGGATTATGCTCGAGCATAATCCTCTACCAATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007204.3-2761s21c1
Sequence:CCGGACCAGTGATTATAGGATATACCTCGAGGTATATCCTATAATCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2822s21c1
Sequence:CCGGTATCCATCCTCCTCGACTTATCTCGAGATAAGTCGAGGAGGATGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2355s21c1
Sequence:CCGGACGCCTGTGGATGATCGTATTCTCGAGAATACGATCATCCACAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-1020s21c1
Sequence:CCGGTCAGCTACTTATCCCGAATTTCTCGAGAAATTCGGGATAAGTAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-2662s1c1
Sequence:CCGGCCGCTTCTCATTCATATTATTCTCGAGAATAATATGAATGAGAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-2356s1c1
Sequence:CCGGCGCCTGTGGATGATCGTATTTCTCGAGAAATACGATCATCCACAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-1124s1c1
Sequence:CCGGGCAGTATTACAAAGTTGTCAACTCGAGTTGACAACTTTGTAATACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-909s1c1
Sequence:CCGGCGCCTCTTTATTCTTGATGAACTCGAGTTCATCAAGAATAAAGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007204.3-3076s1c1
Sequence:CCGGGATGACATATACCACCACTTACTCGAGTAAGTGGTGGTATATGTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007204
VALIDATED
DDX20 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2068s21c1
Sequence:CCGGCTGAATTGGTAGAGGATTATGCTCGAGCATAATCCTCTACCAATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007204.3-2761s21c1
Sequence:CCGGACCAGTGATTATAGGATATACCTCGAGGTATATCCTATAATCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2822s21c1
Sequence:CCGGTATCCATCCTCCTCGACTTATCTCGAGATAAGTCGAGGAGGATGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-2355s21c1
Sequence:CCGGACGCCTGTGGATGATCGTATTCTCGAGAATACGATCATCCACAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007204.3-1020s21c1
Sequence:CCGGTCAGCTACTTATCCCGAATTTCTCGAGAAATTCGGGATAAGTAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-2662s1c1
Sequence:CCGGCCGCTTCTCATTCATATTATTCTCGAGAATAATATGAATGAGAAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-2356s1c1
Sequence:CCGGCGCCTGTGGATGATCGTATTTCTCGAGAAATACGATCATCCACAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007204.3-1124s1c1
Sequence:CCGGGCAGTATTACAAAGTTGTCAACTCGAGTTGACAACTTTGTAATACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007204.3-909s1c1
Sequence:CCGGCGCCTCTTTATTCTTGATGAACTCGAGTTCATCAAGAATAAAGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007886    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007204.3-3076s1c1
Sequence:CCGGGATGACATATACCACCACTTACTCGAGTAAGTGGTGGTATATGTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)