EMAIL THIS PAGE TO A FRIEND

DDX21

DEAD (Asp-Glu-Ala-Asp) box helicase 21

67 Gene Product Result for
Synonyms: GUA GURDB RH-II/GU RH-II/GuA
UniProtKB ID: Q9NR30, B2RDL0, Q13436, Q5VX41, Q68D35
Gene ID:
Human(9188) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
Mouse(56200) DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
Rat(317399) DEAD (Asp-Glu-Ala-Asp) box helicase 21
Zebrafish(799650) DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
domestic cat(101092466) DEAD (Asp-Glu-Ala-Asp) box helicase 21
Horse(100072661) DEAD (Asp-Glu-Ala-Asp) box helicase 21
cow(781917) DEAD (Asp-Glu-Ala-Asp) box polypeptide 21
dog(476891) DEAD (Asp-Glu-Ala-Asp) box helicase 21
domestic guinea pig(100719245) DEAD (Asp-Glu-Ala-Asp) box helicase 21
naked mole-rat(101705140) DEAD (Asp-Glu-Ala-Asp) box helicase 21
sheep(101104037) DEAD (Asp-Glu-Ala-Asp) box helicase 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004728 Rosetta Predictions human pricing
NM_001037201 Rosetta Predictions rat pricing
XM_001053000 Rosetta Predictions rat pricing
NM_019553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338207 predicted 1065
2 SASI_Hs01_00132018 predicted 2462
3 SASI_Hs01_00132020 predicted 2138
4 SASI_Hs01_00132021 predicted 1110
5 SASI_Hs01_00132022 predicted 2086
6 SASI_Hs01_00132023 predicted 887
7 SASI_Hs02_00338208 predicted 1043
8 SASI_Hs01_00132024 predicted 1514
9 SASI_Hs01_00132025 predicted 1392
10 SASI_Hs01_00132026 predicted 1999
11 SASI_Hs01_00132019 predicted 1860
12 SASI_Hs01_00132027 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041397 predicted 824
2 SASI_Rn01_00041398 predicted 1198
3 SASI_Rn01_00041399 predicted 287
4 SASI_Rn01_00041400 predicted 1457
5 SASI_Rn01_00041402 predicted 921
6 SASI_Rn01_00041403 predicted 1959
7 SASI_Rn01_00041404 predicted 1269
8 SASI_Rn01_00041405 predicted 1172
9 SASI_Rn01_00041406 predicted 1932
10 SASI_Rn02_00204310 predicted 199
11 SASI_Rn01_00041401 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270994 predicted 830
2 SASI_Rn02_00270995 predicted 1198
3 SASI_Rn02_00270996 predicted 288
4 SASI_Rn02_00270997 predicted 1453
5 SASI_Rn02_00270998 predicted 917
6 SASI_Rn02_00270999 predicted 1959
7 SASI_Rn02_00271000 predicted 1268
8 SASI_Rn02_00271001 predicted 1164
9 SASI_Rn02_00271002 predicted 1926
10 SASI_Rn02_00271003 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324593 predicted 1463
2 SASI_Mm02_00324594 predicted 1537
3 SASI_Mm02_00324595 predicted 1326
4 SASI_Mm01_00057741 predicted 912
5 SASI_Mm02_00324596 predicted 2024
6 SASI_Mm01_00057742 predicted 1654
7 SASI_Mm01_00057743 predicted 1575
8 SASI_Mm01_00057744 predicted 1443
9 SASI_Mm01_00057745 predicted 826
10 SASI_Mm01_00057746 predicted 1193
11 SASI_Mm01_00057747 predicted 1611
12 SASI_Mm01_00057748 predicted 915
13 SASI_Mm01_00057749 predicted 1706
14 SASI_Mm01_00057750 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004728
VALIDATED
DDX21 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-2383s1c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-635s1c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1940s1c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-972s1c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1571s1c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1969s21c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-664s21c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1600s21c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1001s21c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-2412s21c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004728
VALIDATED
DDX21 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-2383s1c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-635s1c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1940s1c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-972s1c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1571s1c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1969s21c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-664s21c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1600s21c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1001s21c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-2412s21c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004728
VALIDATED
DDX21 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-2383s1c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-635s1c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1940s1c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-972s1c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004728.1-1571s1c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1969s21c1
Sequence:CCGGCGCTCCTTGATCAACTCAAATCTCGAGATTTGAGTTGATCAAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-664s21c1
Sequence:CCGGCCCATATCTGAAGAAACTATTCTCGAGAATAGTTTCTTCAGATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1600s21c1
Sequence:CCGGCCTGAGGTTGATTTGGTTATACTCGAGTATAACCAAATCAACCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-1001s21c1
Sequence:CCGGGCATGAGGAATGGGATTGATACTCGAGTATCAATCCCATTCCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004728.2-2412s21c1
Sequence:CCGGGCGGAGTTTCAGTAAAGCATTCTCGAGAATGCTTTACTGAAACTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019553
VALIDATED
DDX21 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019553.1-3221s1c1
Sequence:CCGGCGTAATGTGTTTGTTTGCATTCTCGAGAATGCAAACAAACACATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1747s1c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1149s1c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-889s1c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1746s1c1
Sequence:CCGGCGCACGATCATCTTCTGTGAACTCGAGTTCACAGAAGATGATCGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-761s21c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1021s21c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019553.2-2978s21c1
Sequence:CCGGTACACACGCCCTGCAACTAAACTCGAGTTTAGTTGCAGGGCGTGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1530s21c1
Sequence:CCGGTGTGGAGCACCTGGCGATTAACTCGAGTTAATCGCCAGGTGCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1619s21c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019553
VALIDATED
DDX21 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019553.1-3221s1c1
Sequence:CCGGCGTAATGTGTTTGTTTGCATTCTCGAGAATGCAAACAAACACATTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1747s1c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1149s1c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-889s1c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1746s1c1
Sequence:CCGGCGCACGATCATCTTCTGTGAACTCGAGTTCACAGAAGATGATCGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-761s21c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1021s21c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019553.2-2978s21c1
Sequence:CCGGTACACACGCCCTGCAACTAAACTCGAGTTTAGTTGCAGGGCGTGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1530s21c1
Sequence:CCGGTGTGGAGCACCTGGCGATTAACTCGAGTTAATCGCCAGGTGCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1619s21c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019553
VALIDATED
DDX21 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019553.1-3221s1c1
Sequence:CCGGCGTAATGTGTTTGTTTGCATTCTCGAGAATGCAAACAAACACATTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1747s1c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1149s1c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-889s1c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019553.1-1746s1c1
Sequence:CCGGCGCACGATCATCTTCTGTGAACTCGAGTTCACAGAAGATGATCGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-761s21c1
Sequence:CCGGCCCAACCTTCTGAACCGAAATCTCGAGATTTCGGTTCAGAAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1021s21c1
Sequence:CCGGGCCATCCCTTTAATTGAGAAACTCGAGTTTCTCAATTAAAGGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019553.2-2978s21c1
Sequence:CCGGTACACACGCCCTGCAACTAAACTCGAGTTTAGTTGCAGGGCGTGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1530s21c1
Sequence:CCGGTGTGGAGCACCTGGCGATTAACTCGAGTTAATCGCCAGGTGCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019553.2-1619s21c1
Sequence:CCGGGCACGATCATCTTCTGTGAAACTCGAGTTTCACAGAAGATGATCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)