EMAIL THIS PAGE TO A FRIEND

DDX23

DEAD (Asp-Glu-Ala-Asp) box polypeptide 23

Synonyms: PRPF28 SNRNP100 U5-100K U5-100KD prp28
UniProtKB ID: Q9BUQ8, B2R600, O43188
Gene ID:
Human(9416) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(74351) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Rat(300208) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
domestic guinea pig(100730016) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
naked mole-rat(101726476) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
sheep(101104730) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Zebrafish(334283) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
dog(477624) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Horse(100051439) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
cow(537395) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
domestic cat(101092374) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
chicken(100858001) DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004818 Rosetta Predictions human pricing
NM_001106793 Rosetta Predictions rat pricing
NM_001080981 Rosetta Predictions mouse pricing
XM_001004293 Rosetta Predictions mouse pricing
XM_619355 Rosetta Predictions mouse pricing
XM_902409 Rosetta Predictions mouse pricing
XM_902413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338372 predicted 744
2 SASI_Hs02_00338373 predicted 1201
3 SASI_Hs01_00230556 predicted 2068
4 SASI_Hs01_00230557 predicted 210
5 SASI_Hs01_00230558 predicted 310
6 SASI_Hs02_00338374 predicted 699
7 SASI_Hs02_00338375 predicted 890
8 SASI_Hs01_00230561 predicted 403
9 SASI_Hs02_00338376 predicted 295
10 SASI_Hs02_00338377 predicted 394
11 SASI_Hs01_00230552 predicted 1290
12 SASI_Hs01_00230553 predicted 2288
13 SASI_Hs01_00230554 predicted 1745
14 SASI_Hs01_00230555 predicted 2299
15 SASI_Hs01_00230559 predicted 854
16 SASI_Hs01_00230560 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222458 predicted 2125
2 SASI_Rn02_00222459 predicted 1877
3 SASI_Rn02_00222460 predicted 2000
4 SASI_Rn02_00222461 predicted 2006
5 SASI_Rn02_00222462 predicted 2074
6 SASI_Rn02_00222463 predicted 2190
7 SASI_Rn02_00222464 predicted 2076
8 SASI_Rn02_00222465 predicted 1751
9 SASI_Rn02_00222466 predicted 1689
10 SASI_Rn02_00222467 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294246 predicted 2262
2 SASI_Mm02_00294247 predicted 892
3 SASI_Mm02_00294248 predicted 1989
4 SASI_Mm02_00294249 predicted 2237
5 SASI_Mm02_00294250 predicted 2238
6 SASI_Mm02_00294251 predicted 971
7 SASI_Mm02_00294252 predicted 1132
8 SASI_Mm02_00294253 predicted 813
9 SASI_Mm02_00294254 predicted 280
10 SASI_Mm02_00294255 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221534 predicted 2784
2 SASI_Mm01_00221535 predicted 2427
3 SASI_Mm01_00221536 predicted 1631
4 SASI_Mm01_00221537 predicted 2814
5 SASI_Mm01_00221538 predicted 1865
6 SASI_Mm01_00221539 predicted 2596
7 SASI_Mm01_00221540 predicted 1864
8 SASI_Mm01_00221541 predicted 1547
9 SASI_Mm01_00221542 predicted 1555
10 SASI_Mm01_00221543 predicted 2621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230319 predicted 1013
2 SASI_Mm01_00230320 predicted 905
3 SASI_Mm01_00230321 predicted 1141
4 SASI_Mm01_00230322 predicted 985
5 SASI_Mm01_00230323 predicted 1140
6 SASI_Mm01_00230324 predicted 226
7 SASI_Mm01_00230325 predicted 253
8 SASI_Mm01_00230326 predicted 1013
9 SASI_Mm01_00230327 predicted 1020
10 SASI_Mm01_00230328 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259296 predicted 729
2 SASI_Mm01_00259297 predicted 474
3 SASI_Mm01_00259298 predicted 731
4 SASI_Mm01_00259299 predicted 224
5 SASI_Mm01_00259300 predicted 557
6 SASI_Mm01_00259301 predicted 462
7 SASI_Mm01_00259302 predicted 255
8 SASI_Mm01_00259303 predicted 526
9 SASI_Mm01_00259304 predicted 421
10 SASI_Mm01_00259305 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231888 predicted 965
2 SASI_Mm01_00231889 predicted 1099
3 SASI_Mm01_00231890 predicted 1152
4 SASI_Mm01_00231891 predicted 933
5 SASI_Mm01_00231892 predicted 1165
6 SASI_Mm01_00231893 predicted 1008
7 SASI_Mm01_00231894 predicted 1169
8 SASI_Mm01_00231895 predicted 1159
9 SASI_Mm01_00231896 predicted 1206
10 SASI_Mm01_00231897 predicted 1037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004818
VALIDATED
DDX23 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-344s21c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-1289s21c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-2267s21c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004818.2-2793s21c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2793s1c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-1289s1c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-344s1c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2267s1c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2060s1c1
Sequence:CCGGGCAATCTTGGAGCAAGGCTTTCTCGAGAAAGCCTTGCTCCAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004818
VALIDATED
DDX23 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-344s21c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-1289s21c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-2267s21c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004818.2-2793s21c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2793s1c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-1289s1c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-344s1c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2267s1c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2060s1c1
Sequence:CCGGGCAATCTTGGAGCAAGGCTTTCTCGAGAAAGCCTTGCTCCAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004818
VALIDATED
DDX23 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-344s21c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-1289s21c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004818.2-2267s21c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004818.2-2793s21c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2793s1c1
Sequence:CCGGGCCCTTCTTTGCTTTGGGATTCTCGAGAATCCCAAAGCAAAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-1289s1c1
Sequence:CCGGCCACACATCTTGGAGGTCATTCTCGAGAATGACCTCCAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004818.2-344s1c1
Sequence:CCGGCGGAATAAGAAGGACCGAGATCTCGAGATCTCGGTCCTTCTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2267s1c1
Sequence:CCGGCGTGGTATTGACATCCAAGATCTCGAGATCTTGGATGTCAATACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004818.2-2060s1c1
Sequence:CCGGGCAATCTTGGAGCAAGGCTTTCTCGAGAAAGCCTTGCTCCAAGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080981
DDX23 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-973s21c1
Sequence:CCGGCATTGCAGGCATTGACCTAAACTCGAGTTTAGGTCAATGCCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-796s21c1
Sequence:CCGGCAAGGAGCTGCACGCCATTAACTCGAGTTAATGGCGTGCAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-1871s21c1
Sequence:CCGGGTCATGTTCACGGCTACTATGCTCGAGCATAGTAGCCGTGAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-2052s21c1
Sequence:CCGGTTGATCCGCCTATCATCATTTCTCGAGAAATGATGATAGGCGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080981.1-2604s21c1
Sequence:CCGGCTTTCTTGGACATGGGCTTAGCTCGAGCTAAGCCCATGTCCAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080981
DDX23 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-973s21c1
Sequence:CCGGCATTGCAGGCATTGACCTAAACTCGAGTTTAGGTCAATGCCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-796s21c1
Sequence:CCGGCAAGGAGCTGCACGCCATTAACTCGAGTTAATGGCGTGCAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-1871s21c1
Sequence:CCGGGTCATGTTCACGGCTACTATGCTCGAGCATAGTAGCCGTGAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-2052s21c1
Sequence:CCGGTTGATCCGCCTATCATCATTTCTCGAGAAATGATGATAGGCGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080981.1-2604s21c1
Sequence:CCGGCTTTCTTGGACATGGGCTTAGCTCGAGCTAAGCCCATGTCCAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080981
DDX23 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-973s21c1
Sequence:CCGGCATTGCAGGCATTGACCTAAACTCGAGTTTAGGTCAATGCCTGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-796s21c1
Sequence:CCGGCAAGGAGCTGCACGCCATTAACTCGAGTTAATGGCGTGCAGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-1871s21c1
Sequence:CCGGGTCATGTTCACGGCTACTATGCTCGAGCATAGTAGCCGTGAACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080981.1-2052s21c1
Sequence:CCGGTTGATCCGCCTATCATCATTTCTCGAGAAATGATGATAGGCGGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080981.1-2604s21c1
Sequence:CCGGCTTTCTTGGACATGGGCTTAGCTCGAGCTAAGCCCATGTCCAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks