EMAIL THIS PAGE TO A FRIEND

DDX24

DEAD (Asp-Glu-Ala-Asp) box helicase 24

UniProtKB ID: Q9GZR7
Gene ID:
Human(57062) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which shows little similarity to any of the other known human DEAD box proteins, but shows a high similarity to mouse Ddx24 at the amino acid level. [provided by RefSeq, Jul 2008]
Mouse(27225) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Rat(373065) DEAD (Asp-Glu-Ala-Asp) box helicase 24
chicken(423429) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
cow(529613) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Horse(100053504) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
domestic cat(101080389) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
dog(480421) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
sheep(101116607) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Domestic Rabbit(100357706) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
naked mole-rat(101709068) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
domestic guinea pig(100734956) DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020414 Rosetta Predictions human pricing
NM_199119 Rosetta Predictions rat pricing
NM_020494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136754 predicted 236
2 SASI_Hs01_00136755 predicted 1866
3 SASI_Hs01_00136756 predicted 1845
4 SASI_Hs01_00136757 predicted 2288
5 SASI_Hs01_00136758 predicted 2668
6 SASI_Hs01_00136759 predicted 1568
7 SASI_Hs01_00136760 predicted 277
8 SASI_Hs01_00136761 predicted 946
9 SASI_Hs01_00136762 predicted 195
10 SASI_Hs01_00136763 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082307 predicted 1919
2 SASI_Rn02_00270145 predicted 1948
3 SASI_Rn01_00082308 predicted 205
4 SASI_Rn01_00082309 predicted 1582
5 SASI_Rn01_00082310 predicted 948
6 SASI_Rn01_00082311 predicted 2179
7 SASI_Rn01_00082312 predicted 802
8 SASI_Rn01_00082314 predicted 2423
9 SASI_Rn02_00270146 predicted 1672
10 SASI_Rn01_00082316 predicted 1297
11 SASI_Rn01_00082313 predicted 1135
12 SASI_Rn01_00082315 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114910 predicted 1368
2 SASI_Mm01_00114911 predicted 2320
3 SASI_Mm01_00114912 predicted 1808
4 SASI_Mm01_00114913 predicted 1369
5 SASI_Mm02_00325545 predicted 1170
6 SASI_Mm01_00114914 predicted 1976
7 SASI_Mm01_00114915 predicted 1978
8 SASI_Mm01_00114916 predicted 367
9 SASI_Mm01_00114918 predicted 422
10 SASI_Mm01_00114919 predicted 1491
11 SASI_Mm01_00114917 predicted 1984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020414
VALIDATED
DDX24 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020414.3-2698s1c1
Sequence:CCGGGACTGCACATTGGTTTCTGTTCTCGAGAACAGAAACCAATGTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-781s1c1
Sequence:CCGGCGTGACAAACTGGACATCCTTCTCGAGAAGGATGTCCAGTTTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020414.3-1742s1c1
Sequence:CCGGCCAAGGTCATTGACCTCACAACTCGAGTTGTGAGGTCAATGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-2102s1c1
Sequence:CCGGCGGAGATTTATGTCCACCGAACTCGAGTTCGGTGGACATAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020414.3-2213s1c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2213s21c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2177s21c1
Sequence:CCGGCTGAGGATGTGATCAACTTTACTCGAGTAAAGTTGATCACATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2285s21c1
Sequence:CCGGTCCGTTTAGCTCGACAGATTGCTCGAGCAATCTGTCGAGCTAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2711s21c1
Sequence:CCGGTTTCTGTTCTCTGGCTATTTGCTCGAGCAAATAGCCAGAGAACAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2091s21c1
Sequence:CCGGCCCACGTACCTCGGAGATTTACTCGAGTAAATCTCCGAGGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020414
VALIDATED
DDX24 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020414.3-2698s1c1
Sequence:CCGGGACTGCACATTGGTTTCTGTTCTCGAGAACAGAAACCAATGTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-781s1c1
Sequence:CCGGCGTGACAAACTGGACATCCTTCTCGAGAAGGATGTCCAGTTTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020414.3-1742s1c1
Sequence:CCGGCCAAGGTCATTGACCTCACAACTCGAGTTGTGAGGTCAATGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-2102s1c1
Sequence:CCGGCGGAGATTTATGTCCACCGAACTCGAGTTCGGTGGACATAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020414.3-2213s1c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2213s21c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2177s21c1
Sequence:CCGGCTGAGGATGTGATCAACTTTACTCGAGTAAAGTTGATCACATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2285s21c1
Sequence:CCGGTCCGTTTAGCTCGACAGATTGCTCGAGCAATCTGTCGAGCTAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2711s21c1
Sequence:CCGGTTTCTGTTCTCTGGCTATTTGCTCGAGCAAATAGCCAGAGAACAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2091s21c1
Sequence:CCGGCCCACGTACCTCGGAGATTTACTCGAGTAAATCTCCGAGGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020414
VALIDATED
DDX24 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020414.3-2698s1c1
Sequence:CCGGGACTGCACATTGGTTTCTGTTCTCGAGAACAGAAACCAATGTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-781s1c1
Sequence:CCGGCGTGACAAACTGGACATCCTTCTCGAGAAGGATGTCCAGTTTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020414.3-1742s1c1
Sequence:CCGGCCAAGGTCATTGACCTCACAACTCGAGTTGTGAGGTCAATGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020414.3-2102s1c1
Sequence:CCGGCGGAGATTTATGTCCACCGAACTCGAGTTCGGTGGACATAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020414.3-2213s1c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2213s21c1
Sequence:CCGGCGCTCAAGAAAGATGAGGATACTCGAGTATCCTCATCTTTCTTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2177s21c1
Sequence:CCGGCTGAGGATGTGATCAACTTTACTCGAGTAAAGTTGATCACATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020414.3-2285s21c1
Sequence:CCGGTCCGTTTAGCTCGACAGATTGCTCGAGCAATCTGTCGAGCTAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2711s21c1
Sequence:CCGGTTTCTGTTCTCTGGCTATTTGCTCGAGCAAATAGCCAGAGAACAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020414.3-2091s21c1
Sequence:CCGGCCCACGTACCTCGGAGATTTACTCGAGTAAATCTCCGAGGTACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020494
VALIDATED
DDX24 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2950s1c1
Sequence:CCGGGCACACATGTTGTGGAGTTAACTCGAGTTAACTCCACAACATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2532s1c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1812s1c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1492s1c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-597s1c1
Sequence:CCGGGCTGCCCAGAATGAGTATGAACTCGAGTTCATACTCATTCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020494.3-1432s21c1
Sequence:CCGGTCGGCTCTGGGAGTTAGTTAACTCGAGTTAACTAACTCCCAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020494.3-2673s21c1
Sequence:CCGGCCGGTCAATGTGGTGACTGTTCTCGAGAACAGTCACCACATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-2366s21c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1326s21c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1646s21c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020494
VALIDATED
DDX24 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2950s1c1
Sequence:CCGGGCACACATGTTGTGGAGTTAACTCGAGTTAACTCCACAACATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2532s1c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1812s1c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1492s1c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-597s1c1
Sequence:CCGGGCTGCCCAGAATGAGTATGAACTCGAGTTCATACTCATTCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020494.3-1432s21c1
Sequence:CCGGTCGGCTCTGGGAGTTAGTTAACTCGAGTTAACTAACTCCCAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020494.3-2673s21c1
Sequence:CCGGCCGGTCAATGTGGTGACTGTTCTCGAGAACAGTCACCACATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-2366s21c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1326s21c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1646s21c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020494
VALIDATED
DDX24 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 24
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2950s1c1
Sequence:CCGGGCACACATGTTGTGGAGTTAACTCGAGTTAACTCCACAACATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-2532s1c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1812s1c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-1492s1c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020494.2-597s1c1
Sequence:CCGGGCTGCCCAGAATGAGTATGAACTCGAGTTCATACTCATTCTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020494.3-1432s21c1
Sequence:CCGGTCGGCTCTGGGAGTTAGTTAACTCGAGTTAACTAACTCCCAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020494.3-2673s21c1
Sequence:CCGGCCGGTCAATGTGGTGACTGTTCTCGAGAACAGTCACCACATTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-2366s21c1
Sequence:CCGGGCCCTAGAGATTGAGCTAGAACTCGAGTTCTAGCTCAATCTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1326s21c1
Sequence:CCGGCCAAGTTTACAGGGATTAATACTCGAGTATTAATCCCTGTAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020494.3-1646s21c1
Sequence:CCGGGCTCGAATCCTTCATAAGAAACTCGAGTTTCTTATGAAGGATTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks