EMAIL THIS PAGE TO A FRIEND

DDX25

DEAD (Asp-Glu-Ala-Asp) box helicase 25

61 Gene Product Result for
Synonyms: GRTH
UniProtKB ID: Q9UHL0, B2R6Z0, Q5XVN2, Q86W81, Q8IYP1
Gene ID:
Human(29118) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(30959) DEAD (Asp-Glu-Ala-Asp) box polypeptide 25
Rat(58856) DEAD (Asp-Glu-Ala-Asp) box helicase 25
domestic guinea pig(100715526) DEAD (Asp-Glu-Ala-Asp) box helicase 25
naked mole-rat(101710403) DEAD (Asp-Glu-Ala-Asp) box helicase 25
sheep(101113022) DEAD (Asp-Glu-Ala-Asp) box helicase 25
chicken(427073) DEAD (Asp-Glu-Ala-Asp) box helicase 25
cow(508962) DEAD (Asp-Glu-Ala-Asp) box polypeptide 25
domestic cat(101087004) DEAD (Asp-Glu-Ala-Asp) box helicase 25
dog(479396) DEAD (Asp-Glu-Ala-Asp) box helicase 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36410 Anti-DDX25 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, human, guinea pig, rabbit, mouse, canine
western blot pricing
HPA020137 Anti-DDX25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
SAB2100551 Anti-DDX25 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, bovine, human, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013264 Rosetta Predictions human pricing
NM_031630 Rosetta Predictions rat pricing
NM_013932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344487 predicted 920
2 SASI_Hs02_00344488 predicted 775
3 SASI_Hs02_00344489 predicted 347
4 SASI_Hs01_00228702 predicted 1062
5 SASI_Hs02_00344490 predicted 431
6 SASI_Hs01_00228704 predicted 1357
7 SASI_Hs01_00228705 predicted 1334
8 SASI_Hs01_00228707 predicted 1020
9 SASI_Hs01_00228710 predicted 597
10 SASI_Hs01_00228711 predicted 914
11 SASI_Hs01_00228703 predicted 934
12 SASI_Hs01_00228706 predicted 1398
13 SASI_Hs01_00228708 predicted 648
14 SASI_Hs01_00228709 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087878 predicted 211
2 SASI_Rn01_00087879 predicted 1276
3 SASI_Rn01_00087880 predicted 311
4 SASI_Rn02_00264935 predicted 551
5 SASI_Rn01_00087882 predicted 1120
6 SASI_Rn01_00087883 predicted 959
7 SASI_Rn01_00087884 predicted 504
8 SASI_Rn01_00087885 predicted 1192
9 SASI_Rn01_00087886 predicted 193
10 SASI_Rn01_00087887 predicted 715
11 SASI_Rn01_00087881 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162658 predicted 1238
2 SASI_Mm02_00323032 predicted 257
3 SASI_Mm01_00162659 predicted 593
4 SASI_Mm01_00162661 predicted 1079
5 SASI_Mm02_00323033 predicted 1270
6 SASI_Mm02_00323034 predicted 241
7 SASI_Mm02_00323035 predicted 1297
8 SASI_Mm01_00162662 predicted 930
9 SASI_Mm01_00162663 predicted 704
10 SASI_Mm02_00323036 predicted 242
11 SASI_Mm01_00162657 predicted 772
12 SASI_Mm01_00162660 predicted 544
13 SASI_Mm01_00162664 predicted 1044
14 SASI_Mm01_00162665 predicted 832
15 SASI_Mm01_00162666 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013264
VALIDATED
DDX25 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-402s21c1
Sequence:CCGGGGATCCCAGCTCTCCACTTTACTCGAGTAAAGTGGAGAGCTGGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-916s21c1
Sequence:CCGGTCAGATCATAGTATTCGTATTCTCGAGAATACGAATACTATGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-580s21c1
Sequence:CCGGACAGGAAAGACAGCGGCATTTCTCGAGAAATGCCGCTGTCTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-487s21c1
Sequence:CCGGGGATTTAATAGGCCATCTAAACTCGAGTTTAGATGGCCTATTAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013264.3-1610s21c1
Sequence:CCGGTTTGTGCAGTATCCTAGTTTACTCGAGTAAACTAGGATACTGCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-1028s21c1
Sequence:CCGGACCCTAATGTTATCAAGTTACCTCGAGGTAACTTGATAACATTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013264.2-1554s1c1
Sequence:CCGGCGACGTGAAACTGTCACAGATCTCGAGATCTGTGACAGTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-1501s1c1
Sequence:CCGGGTGAGAATGTCTCAGTGGGTTCTCGAGAACCCACTGAGACATTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-935s1c1
Sequence:CCGGCTGAACAACATCCGGCAATATCTCGAGATATTGCCGGATGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-999s1c1
Sequence:CCGGGCAACATTTATGGCAGCATCACTCGAGTGATGCTGCCATAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-486s1c1
Sequence:CCGGGCAGAGTTAATGCCTTGGAATCTCGAGATTCCAAGGCATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_013264.2-525s1c1
Sequence:CCGGGCCTAGCTCCTACTTATGAATCTCGAGATTCATAAGTAGGAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-758s1c1
Sequence:CCGGGATGTGATGATTGACACTCAACTCGAGTTGAGTGTCAATCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-1391s1c1
Sequence:CCGGGACCACTTTAACAGCAGTATTCTCGAGAATACTGCTGTTAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-1241s1c1
Sequence:CCGGGTGAACTTTGATCTCCCTGTACTCGAGTACAGGGAGATCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013264
VALIDATED
DDX25 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-402s21c1
Sequence:CCGGGGATCCCAGCTCTCCACTTTACTCGAGTAAAGTGGAGAGCTGGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-916s21c1
Sequence:CCGGTCAGATCATAGTATTCGTATTCTCGAGAATACGAATACTATGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-580s21c1
Sequence:CCGGACAGGAAAGACAGCGGCATTTCTCGAGAAATGCCGCTGTCTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-487s21c1
Sequence:CCGGGGATTTAATAGGCCATCTAAACTCGAGTTTAGATGGCCTATTAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013264.3-1610s21c1
Sequence:CCGGTTTGTGCAGTATCCTAGTTTACTCGAGTAAACTAGGATACTGCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-1028s21c1
Sequence:CCGGACCCTAATGTTATCAAGTTACCTCGAGGTAACTTGATAACATTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013264.2-1554s1c1
Sequence:CCGGCGACGTGAAACTGTCACAGATCTCGAGATCTGTGACAGTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-1501s1c1
Sequence:CCGGGTGAGAATGTCTCAGTGGGTTCTCGAGAACCCACTGAGACATTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-935s1c1
Sequence:CCGGCTGAACAACATCCGGCAATATCTCGAGATATTGCCGGATGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-999s1c1
Sequence:CCGGGCAACATTTATGGCAGCATCACTCGAGTGATGCTGCCATAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-486s1c1
Sequence:CCGGGCAGAGTTAATGCCTTGGAATCTCGAGATTCCAAGGCATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_013264.2-525s1c1
Sequence:CCGGGCCTAGCTCCTACTTATGAATCTCGAGATTCATAAGTAGGAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-758s1c1
Sequence:CCGGGATGTGATGATTGACACTCAACTCGAGTTGAGTGTCAATCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-1391s1c1
Sequence:CCGGGACCACTTTAACAGCAGTATTCTCGAGAATACTGCTGTTAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-1241s1c1
Sequence:CCGGGTGAACTTTGATCTCCCTGTACTCGAGTACAGGGAGATCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013264
VALIDATED
DDX25 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-402s21c1
Sequence:CCGGGGATCCCAGCTCTCCACTTTACTCGAGTAAAGTGGAGAGCTGGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-916s21c1
Sequence:CCGGTCAGATCATAGTATTCGTATTCTCGAGAATACGAATACTATGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-580s21c1
Sequence:CCGGACAGGAAAGACAGCGGCATTTCTCGAGAAATGCCGCTGTCTTTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-487s21c1
Sequence:CCGGGGATTTAATAGGCCATCTAAACTCGAGTTTAGATGGCCTATTAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013264.3-1610s21c1
Sequence:CCGGTTTGTGCAGTATCCTAGTTTACTCGAGTAAACTAGGATACTGCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013264.3-1028s21c1
Sequence:CCGGACCCTAATGTTATCAAGTTACCTCGAGGTAACTTGATAACATTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013264.2-1554s1c1
Sequence:CCGGCGACGTGAAACTGTCACAGATCTCGAGATCTGTGACAGTTTCACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-1501s1c1
Sequence:CCGGGTGAGAATGTCTCAGTGGGTTCTCGAGAACCCACTGAGACATTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-935s1c1
Sequence:CCGGCTGAACAACATCCGGCAATATCTCGAGATATTGCCGGATGTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-999s1c1
Sequence:CCGGGCAACATTTATGGCAGCATCACTCGAGTGATGCTGCCATAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-486s1c1
Sequence:CCGGGCAGAGTTAATGCCTTGGAATCTCGAGATTCCAAGGCATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_013264.2-525s1c1
Sequence:CCGGGCCTAGCTCCTACTTATGAATCTCGAGATTCATAAGTAGGAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_013264.2-758s1c1
Sequence:CCGGGATGTGATGATTGACACTCAACTCGAGTTGAGTGTCAATCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013264.2-1391s1c1
Sequence:CCGGGACCACTTTAACAGCAGTATTCTCGAGAATACTGCTGTTAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013264.2-1241s1c1
Sequence:CCGGGTGAACTTTGATCTCCCTGTACTCGAGTACAGGGAGATCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013932
VALIDATED
DDX25 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-958s1c1
Sequence:CCGGCCAATGTTATCAAGTTGCGAACTCGAGTTCGCAACTTGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-1540s1c1
Sequence:CCGGGCCTTCGTTGTTTGTGGGCTACTCGAGTAGCCCACAAACAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-1446s1c1
Sequence:CCGGCAAGACCACTTCAATAGCAATCTCGAGATTGCTATTGAAGTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-523s1c1
Sequence:CCGGCCTTTGTCTTAGCAATGCTAACTCGAGTTAGCATTGCTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-959s1c1
Sequence:CCGGCAATGTTATCAAGTTGCGAAACTCGAGTTTCGCAACTTGATAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013932
VALIDATED
DDX25 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-958s1c1
Sequence:CCGGCCAATGTTATCAAGTTGCGAACTCGAGTTCGCAACTTGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-1540s1c1
Sequence:CCGGGCCTTCGTTGTTTGTGGGCTACTCGAGTAGCCCACAAACAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-1446s1c1
Sequence:CCGGCAAGACCACTTCAATAGCAATCTCGAGATTGCTATTGAAGTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-523s1c1
Sequence:CCGGCCTTTGTCTTAGCAATGCTAACTCGAGTTAGCATTGCTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-959s1c1
Sequence:CCGGCAATGTTATCAAGTTGCGAAACTCGAGTTTCGCAACTTGATAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013932
VALIDATED
DDX25 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-958s1c1
Sequence:CCGGCCAATGTTATCAAGTTGCGAACTCGAGTTCGCAACTTGATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013932.2-1540s1c1
Sequence:CCGGGCCTTCGTTGTTTGTGGGCTACTCGAGTAGCCCACAAACAACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-1446s1c1
Sequence:CCGGCAAGACCACTTCAATAGCAATCTCGAGATTGCTATTGAAGTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-523s1c1
Sequence:CCGGCCTTTGTCTTAGCAATGCTAACTCGAGTTAGCATTGCTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013932.2-959s1c1
Sequence:CCGGCAATGTTATCAAGTTGCGAAACTCGAGTTTCGCAACTTGATAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks