EMAIL THIS PAGE TO A FRIEND

DDX26B

DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B

100 Gene Product Result for
UniProtKB ID: Q5JSJ4, Q5CZA2, Q6IPS3, Q6ZTU5, Q6ZWE4
Gene ID:
Mouse(236790) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Rat(681665) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Zebrafish(393406) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Horse(100057188) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
dog(492161) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
chicken(422239) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
sheep(101105554) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Domestic Rabbit(100350596) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
naked mole-rat(101704768) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182540 Rosetta Predictions human pricing
NM_172779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370648 predicted 1172
2 SASI_Hs01_00040767 predicted 1446
3 SASI_Hs01_00040769 predicted 1371
4 SASI_Hs02_00370649 predicted 1010
5 SASI_Hs02_00370650 predicted 1210
6 SASI_Hs01_00040770 predicted 1155
7 SASI_Hs01_00040771 predicted 1644
8 SASI_Hs01_00040773 predicted 1377
9 SASI_Hs01_00040774 predicted 2277
10 SASI_Hs01_00040775 predicted 1477
11 SASI_Hs01_00040768 predicted 2617
12 SASI_Hs01_00040772 predicted 1959
13 SASI_Hs01_00040776 predicted 2182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099635 predicted 1946
2 SASI_Mm02_00344673 predicted 2468
3 SASI_Mm01_00099636 predicted 2515
4 SASI_Mm01_00099637 predicted 2521
5 SASI_Mm01_00099638 predicted 2647
6 SASI_Mm01_00099639 predicted 2481
7 SASI_Mm01_00099640 predicted 392
8 SASI_Mm01_00099641 predicted 2688
9 SASI_Mm01_00099642 predicted 983
10 SASI_Mm01_00099643 predicted 1842
11 SASI_Mm01_00099644 predicted 1449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182540
VALIDATED
DDX26B MISSION shRNA Bacterial Glycerol Stock
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1337s1c1
Sequence:CCGGCCTTCGCCCTTAACTCAGTATCTCGAGATACTGAGTTAAGGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-1265s1c1
Sequence:CCGGGTGAGGTTCTCCTGTGTAGATCTCGAGATCTACACAGGAGAACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1244s1c1
Sequence:CCGGCCACGAACATCTCATCCTGTTCTCGAGAACAGGATGAGATGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-714s1c1
Sequence:CCGGCCATCACAGATGGAAACAAGTCTCGAGACTTGTTTCCATCTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-545s1c1
Sequence:CCGGGCAACATTCATGAGCGAACTACTCGAGTAGTTCGCTCATGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-424s1c1
Sequence:CCGGCGCTGTGGAGTTATTCTTGAACTCGAGTTCAAGAATAACTCCACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-821s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1342s1c1
Sequence:CCGGGCCCTTAACTCAGTATATCTTCTCGAGAAGATATACTGAGTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1180s21c1
Sequence:CCGGTATGTACGACCTAACTCTAAACTCGAGTTTAGAGTTAGGTCGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-2015s21c1
Sequence:CCGGTTGCACAAATGGGTAACTATCCTCGAGGATAGTTACCCATTTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-851s21c1
Sequence:CCGGGTTGGGATCAAAGGTTATTTGCTCGAGCAAATAACCTTTGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-1631s21c1
Sequence:CCGGTGCCTCCATACTACCTATTAACTCGAGTTAATAGGTAGTATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1459s21c1
Sequence:CCGGGGATATCCATTTGGTTATTTACTCGAGTAAATAACCAAATGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182540.4-3427s21c1
Sequence:CCGGTGCAATATTCAGGATAGTTTGCTCGAGCAAACTATCCTGAATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182540
VALIDATED
DDX26B MISSION shRNA shRNA Plasmid DNA
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1337s1c1
Sequence:CCGGCCTTCGCCCTTAACTCAGTATCTCGAGATACTGAGTTAAGGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-1265s1c1
Sequence:CCGGGTGAGGTTCTCCTGTGTAGATCTCGAGATCTACACAGGAGAACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1244s1c1
Sequence:CCGGCCACGAACATCTCATCCTGTTCTCGAGAACAGGATGAGATGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-714s1c1
Sequence:CCGGCCATCACAGATGGAAACAAGTCTCGAGACTTGTTTCCATCTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-545s1c1
Sequence:CCGGGCAACATTCATGAGCGAACTACTCGAGTAGTTCGCTCATGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-424s1c1
Sequence:CCGGCGCTGTGGAGTTATTCTTGAACTCGAGTTCAAGAATAACTCCACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-821s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1342s1c1
Sequence:CCGGGCCCTTAACTCAGTATATCTTCTCGAGAAGATATACTGAGTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1180s21c1
Sequence:CCGGTATGTACGACCTAACTCTAAACTCGAGTTTAGAGTTAGGTCGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-2015s21c1
Sequence:CCGGTTGCACAAATGGGTAACTATCCTCGAGGATAGTTACCCATTTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-851s21c1
Sequence:CCGGGTTGGGATCAAAGGTTATTTGCTCGAGCAAATAACCTTTGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-1631s21c1
Sequence:CCGGTGCCTCCATACTACCTATTAACTCGAGTTAATAGGTAGTATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1459s21c1
Sequence:CCGGGGATATCCATTTGGTTATTTACTCGAGTAAATAACCAAATGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182540.4-3427s21c1
Sequence:CCGGTGCAATATTCAGGATAGTTTGCTCGAGCAAACTATCCTGAATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182540
VALIDATED
DDX26B MISSION shRNA Lentiviral Transduction Particles
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1337s1c1
Sequence:CCGGCCTTCGCCCTTAACTCAGTATCTCGAGATACTGAGTTAAGGGCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-1265s1c1
Sequence:CCGGGTGAGGTTCTCCTGTGTAGATCTCGAGATCTACACAGGAGAACCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1244s1c1
Sequence:CCGGCCACGAACATCTCATCCTGTTCTCGAGAACAGGATGAGATGTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-714s1c1
Sequence:CCGGCCATCACAGATGGAAACAAGTCTCGAGACTTGTTTCCATCTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-545s1c1
Sequence:CCGGGCAACATTCATGAGCGAACTACTCGAGTAGTTCGCTCATGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182540.1-424s1c1
Sequence:CCGGCGCTGTGGAGTTATTCTTGAACTCGAGTTCAAGAATAACTCCACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-821s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182540.1-1342s1c1
Sequence:CCGGGCCCTTAACTCAGTATATCTTCTCGAGAAGATATACTGAGTTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1180s21c1
Sequence:CCGGTATGTACGACCTAACTCTAAACTCGAGTTTAGAGTTAGGTCGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-2015s21c1
Sequence:CCGGTTGCACAAATGGGTAACTATCCTCGAGGATAGTTACCCATTTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-851s21c1
Sequence:CCGGGTTGGGATCAAAGGTTATTTGCTCGAGCAAATAACCTTTGATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182540.4-1631s21c1
Sequence:CCGGTGCCTCCATACTACCTATTAACTCGAGTTAATAGGTAGTATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182540.4-1459s21c1
Sequence:CCGGGGATATCCATTTGGTTATTTACTCGAGTAAATAACCAAATGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182540.4-3427s21c1
Sequence:CCGGTGCAATATTCAGGATAGTTTGCTCGAGCAAACTATCCTGAATATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172779
VALIDATED
DDX26B MISSION shRNA Bacterial Glycerol Stock
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-3415s1c1
Sequence:CCGGGCTGCTATTTCGGTAACTTAACTCGAGTTAAGTTACCGAAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-816s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-1333s1c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172779.1-1488s1c1
Sequence:CCGGCCTTACAACTACCCAGTCTTACTCGAGTAAGACTGGGTAGTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-2664s1c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2516s21c1
Sequence:CCGGCATTCACAAACCTGGTAATAACTCGAGTTATTACCAGGTTTGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2664s21c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1333s21c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1278s21c1
Sequence:CCGGGATTGTGAACCAATGGTTATACTCGAGTATAACCATTGGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172779.3-2974s21c1
Sequence:CCGGTTACTGAAGCCCTATAGTATGCTCGAGCATACTATAGGGCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172779
VALIDATED
DDX26B MISSION shRNA shRNA Plasmid DNA
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-3415s1c1
Sequence:CCGGGCTGCTATTTCGGTAACTTAACTCGAGTTAAGTTACCGAAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-816s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-1333s1c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172779.1-1488s1c1
Sequence:CCGGCCTTACAACTACCCAGTCTTACTCGAGTAAGACTGGGTAGTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-2664s1c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2516s21c1
Sequence:CCGGCATTCACAAACCTGGTAATAACTCGAGTTATTACCAGGTTTGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2664s21c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1333s21c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1278s21c1
Sequence:CCGGGATTGTGAACCAATGGTTATACTCGAGTATAACCATTGGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172779.3-2974s21c1
Sequence:CCGGTTACTGAAGCCCTATAGTATGCTCGAGCATACTATAGGGCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172779
VALIDATED
DDX26B MISSION shRNA Lentiviral Transduction Particles
DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-3415s1c1
Sequence:CCGGGCTGCTATTTCGGTAACTTAACTCGAGTTAAGTTACCGAAATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-816s1c1
Sequence:CCGGCGTTGGGATCAAAGGTTATTTCTCGAGAAATAACCTTTGATCCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-1333s1c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172779.1-1488s1c1
Sequence:CCGGCCTTACAACTACCCAGTCTTACTCGAGTAAGACTGGGTAGTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172779.1-2664s1c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2516s21c1
Sequence:CCGGCATTCACAAACCTGGTAATAACTCGAGTTATTACCAGGTTTGTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-2664s21c1
Sequence:CCGGGCTGACATAAAGCATCAATTACTCGAGTAATTGATGCTTTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1333s21c1
Sequence:CCGGCGTCTCCCTTAACTCAGTATACTCGAGTATACTGAGTTAAGGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172779.3-1278s21c1
Sequence:CCGGGATTGTGAACCAATGGTTATACTCGAGTATAACCATTGGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172779.3-2974s21c1
Sequence:CCGGTTACTGAAGCCCTATAGTATGCTCGAGCATACTATAGGGCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks