EMAIL THIS PAGE TO A FRIEND

DDX27

DEAD (Asp-Glu-Ala-Asp) box polypeptide 27

68 Gene Product Result for
Synonyms: DRS1 Drs1p PP3241 RHLP dJ686N3.1
Gene ID:
Human(55661) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, the function of which has not been determined. [provided by RefSeq, Jul 2008]
Mouse(228889) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Rat(362274) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Zebrafish(378844) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
cow(514567) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Horse(100071375) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
domestic cat(101082302) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
chicken(419308) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
dog(477259) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
domestic guinea pig(100734058) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
naked mole-rat(101704264) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
sheep(101120854) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Domestic Rabbit(100357778) DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36447 Anti-DDX27 antibody produced in rabbit IgG fraction of antiserum horse, human, rat, guinea pig, canine, mouse, bovine, rabbit
western blot pricing
SAB2100552 Anti-DDX27 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit, mouse, rat
western blot pricing
HPA047087 Anti-DDX27 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017895 Rosetta Predictions human pricing
XM_001075340 Rosetta Predictions rat pricing
XM_342582 Rosetta Predictions rat pricing
NM_153065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092918 predicted 1621
2 SASI_Hs02_00350866 predicted 1328
3 SASI_Hs01_00092922 predicted 1720
4 SASI_Hs01_00092923 predicted 1399
5 SASI_Hs02_00350867 predicted 1238
6 SASI_Hs02_00350868 predicted 1051
7 SASI_Hs01_00092925 predicted 1762
8 SASI_Hs02_00350869 predicted 305
9 SASI_Hs01_00092927 predicted 1131
10 SASI_Hs02_00350870 predicted 1387
11 SASI_Hs01_00092919 predicted 1850
12 SASI_Hs01_00092920 predicted 1803
13 SASI_Hs01_00092921 predicted 1278
14 SASI_Hs01_00092924 predicted 1215
15 SASI_Hs01_00092926 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349386 predicted 387
2 SASI_Rn02_00349387 predicted 348
3 SASI_Rn02_00349388 predicted 412
4 SASI_Rn02_00349389 predicted 342
5 SASI_Rn02_00349390 predicted 275
6 SASI_Rn02_00349391 predicted 386
7 SASI_Rn02_00349392 predicted 364
8 SASI_Rn02_00349393 predicted 401
9 SASI_Rn02_00349394 predicted 231
10 SASI_Rn02_00349395 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394509 predicted 1341
2 SASI_Rn02_00394510 predicted 1984
3 SASI_Rn02_00394511 predicted 783
4 SASI_Rn02_00394512 predicted 1502
5 SASI_Rn02_00394513 predicted 793
6 SASI_Rn02_00394514 predicted 1239
7 SASI_Rn02_00394515 predicted 797
8 SASI_Rn02_00394516 predicted 1575
9 SASI_Rn02_00394517 predicted 1451
10 SASI_Rn02_00394518 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342880 predicted 1702
2 SASI_Mm02_00342881 predicted 850
3 SASI_Mm02_00342882 predicted 1176
4 SASI_Mm02_00342883 predicted 1922
5 SASI_Mm02_00342884 predicted 268
6 SASI_Mm02_00342885 predicted 2284
7 SASI_Mm02_00342886 predicted 1439
8 SASI_Mm02_00342887 predicted 1703
9 SASI_Mm02_00342888 predicted 2351
10 SASI_Mm02_00342889 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017895
VALIDATED
DDX27 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2512s21c1
Sequence:CCGGCATCCTGGCTGGTCTGTCTTTCTCGAGAAAGACAGACCAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1780s21c1
Sequence:CCGGGATGCTGAAGGAGATTGTAAACTCGAGTTTACAATCTCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1681s21c1
Sequence:CCGGGCCTAATACCATCAAACATTACTCGAGTAATGTTTGATGGTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1185s21c1
Sequence:CCGGGGATGCTGGATGAGTACTTTGCTCGAGCAAAGTACTCATCCAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-2402s21c1
Sequence:CCGGAGACGAGGAGGAAACTTTAAACTCGAGTTTAAAGTTTCCTCCTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2454s21c1
Sequence:CCGGTGTCGTGGCCTGAAGAAATTCCTCGAGGAATTTCTTCAGGCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1936s21c1
Sequence:CCGGGTCAGAAGCCCAGATCAATACCTCGAGGTATTGATCTGGGCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2095s1c1
Sequence:CCGGGCAGAGGAAAGGTCTCAGTTTCTCGAGAAACTGAGACCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-1797s1c1
Sequence:CCGGCCTCAAATTCCGGGACAAGATCTCGAGATCTTGTCCCGGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2285s1c1
Sequence:CCGGCCCTGAAACAGTATCGAGCTACTCGAGTAGCTCGATACTGTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2013s1c1
Sequence:CCGGGCAGGAATTTGACTTGGCCTTCTCGAGAAGGCCAAGTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017895
VALIDATED
DDX27 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2512s21c1
Sequence:CCGGCATCCTGGCTGGTCTGTCTTTCTCGAGAAAGACAGACCAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1780s21c1
Sequence:CCGGGATGCTGAAGGAGATTGTAAACTCGAGTTTACAATCTCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1681s21c1
Sequence:CCGGGCCTAATACCATCAAACATTACTCGAGTAATGTTTGATGGTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1185s21c1
Sequence:CCGGGGATGCTGGATGAGTACTTTGCTCGAGCAAAGTACTCATCCAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-2402s21c1
Sequence:CCGGAGACGAGGAGGAAACTTTAAACTCGAGTTTAAAGTTTCCTCCTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2454s21c1
Sequence:CCGGTGTCGTGGCCTGAAGAAATTCCTCGAGGAATTTCTTCAGGCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1936s21c1
Sequence:CCGGGTCAGAAGCCCAGATCAATACCTCGAGGTATTGATCTGGGCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2095s1c1
Sequence:CCGGGCAGAGGAAAGGTCTCAGTTTCTCGAGAAACTGAGACCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-1797s1c1
Sequence:CCGGCCTCAAATTCCGGGACAAGATCTCGAGATCTTGTCCCGGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2285s1c1
Sequence:CCGGCCCTGAAACAGTATCGAGCTACTCGAGTAGCTCGATACTGTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2013s1c1
Sequence:CCGGGCAGGAATTTGACTTGGCCTTCTCGAGAAGGCCAAGTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017895
VALIDATED
DDX27 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2512s21c1
Sequence:CCGGCATCCTGGCTGGTCTGTCTTTCTCGAGAAAGACAGACCAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1780s21c1
Sequence:CCGGGATGCTGAAGGAGATTGTAAACTCGAGTTTACAATCTCCTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1681s21c1
Sequence:CCGGGCCTAATACCATCAAACATTACTCGAGTAATGTTTGATGGTATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1185s21c1
Sequence:CCGGGGATGCTGGATGAGTACTTTGCTCGAGCAAAGTACTCATCCAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-2402s21c1
Sequence:CCGGAGACGAGGAGGAAACTTTAAACTCGAGTTTAAAGTTTCCTCCTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017895.7-2454s21c1
Sequence:CCGGTGTCGTGGCCTGAAGAAATTCCTCGAGGAATTTCTTCAGGCCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017895.7-1936s21c1
Sequence:CCGGGTCAGAAGCCCAGATCAATACCTCGAGGTATTGATCTGGGCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2095s1c1
Sequence:CCGGGCAGAGGAAAGGTCTCAGTTTCTCGAGAAACTGAGACCTTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-1797s1c1
Sequence:CCGGCCTCAAATTCCGGGACAAGATCTCGAGATCTTGTCCCGGAATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2285s1c1
Sequence:CCGGCCCTGAAACAGTATCGAGCTACTCGAGTAGCTCGATACTGTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017895.6-2013s1c1
Sequence:CCGGGCAGGAATTTGACTTGGCCTTCTCGAGAAGGCCAAGTCAAATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153065
VALIDATED
DDX27 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-457s21c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-193s21c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-271s21c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-166s21c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-645s21c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-166s1c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-193s1c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-457s1c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-271s1c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-645s1c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153065
VALIDATED
DDX27 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-457s21c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-193s21c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-271s21c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-166s21c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-645s21c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-166s1c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-193s1c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-457s1c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-271s1c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-645s1c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153065
VALIDATED
DDX27 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-457s21c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-193s21c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-271s21c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-166s21c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153065.3-645s21c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-166s1c1
Sequence:CCGGGCTGACTTCAACCCTGACTTTCTCGAGAAAGTCAGGGTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-193s1c1
Sequence:CCGGACTGAGAAGGAGGGCATGTATCTCGAGATACATGCCCTCCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-457s1c1
Sequence:CCGGGATGAGGAAATCCTCACCAAACTCGAGTTTGGTGAGGATTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153065.1-271s1c1
Sequence:CCGGACTACACTAGATGAGAAGATTCTCGAGAATCTTCTCATCTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153065.1-645s1c1
Sequence:CCGGGCCAATCCAGAAGGCGTGTATCTCGAGATACACGCCTTCTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks