EMAIL THIS PAGE TO A FRIEND

DDX28

DEAD (Asp-Glu-Ala-Asp) box polypeptide 28

Synonyms: MDDX28
UniProtKB ID: Q9NUL7
Gene ID:
Human(55794) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Mouse(71986) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Rat(364995) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
sheep(101111117) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
naked mole-rat(101697954) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
domestic guinea pig(100728991) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Zebrafish(768189) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
domestic cat(101083471) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
dog(489747) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
cow(539411) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
chicken(427544) DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018380 Rosetta Predictions human pricing
NM_001108898 Rosetta Predictions rat pricing
NM_028038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351860 predicted 1722
2 SASI_Hs02_00351861 predicted 1838
3 SASI_Hs01_00157183 predicted 2179
4 SASI_Hs01_00157184 predicted 2074
5 SASI_Hs01_00157185 predicted 2089
6 SASI_Hs02_00351862 predicted 2001
7 SASI_Hs02_00351863 predicted 2416
8 SASI_Hs01_00157186 predicted 2513
9 SASI_Hs01_00157188 predicted 1961
10 SASI_Hs01_00157189 predicted 1969
11 SASI_Hs01_00157181 predicted 2378
12 SASI_Hs01_00157182 predicted 1477
13 SASI_Hs01_00157187 predicted 1132
14 SASI_Hs01_00157190 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243175 predicted 1638
2 SASI_Rn02_00243176 predicted 1159
3 SASI_Rn02_00243177 predicted 740
4 SASI_Rn02_00243178 predicted 409
5 SASI_Rn02_00243179 predicted 1302
6 SASI_Rn02_00243180 predicted 1579
7 SASI_Rn02_00243181 predicted 1099
8 SASI_Rn02_00243182 predicted 1638
9 SASI_Rn02_00243183 predicted 831
10 SASI_Rn02_00243184 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070813 predicted 737
2 SASI_Mm01_00070814 predicted 1408
3 SASI_Mm01_00070815 predicted 1310
4 SASI_Mm01_00070816 predicted 1020
5 SASI_Mm01_00070817 predicted 1529
6 SASI_Mm01_00070818 predicted 1436
7 SASI_Mm01_00070819 predicted 1263
8 SASI_Mm01_00070820 predicted 1350
9 SASI_Mm01_00070821 predicted 1013
10 SASI_Mm02_00333199 predicted 323
11 SASI_Mm01_00070822 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018380
DDX28 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1478s1c1
Sequence:CCGGCCTTGTTCCTTCCCGAGAATTCTCGAGAATTCTCGGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1941s1c1
Sequence:CCGGCCTCATGTGAAACAGACATTTCTCGAGAAATGTCTGTTTCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1863s1c1
Sequence:CCGGGTAGGCCAGTTGCTGAATAAACTCGAGTTTATTCAGCAACTGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-2384s1c1
Sequence:CCGGCCTGGTTCAGAAGATTGAGCTCTCGAGAGCTCAATCTTCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1207s1c1
Sequence:CCGGCGGTGCGAAAGCTCTCGTCTACTCGAGTAGACGAGAGCTTTCGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1209s21c1
Sequence:CCGGGTGCGAAAGCTCTCGTCTAAGCTCGAGCTTAGACGAGAGCTTTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1861s21c1
Sequence:CCGGGTGTAGGCCAGTTGCTGAATACTCGAGTATTCAGCAACTGGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018380.2-2503s21c1
Sequence:CCGGATGCTAGAACAGGGATCTTTCCTCGAGGAAAGATCCCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2434s21c1
Sequence:CCGGGACTAGCATCCTCGGTGAAAGCTCGAGCTTTCACCGAGGATGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2082s21c1
Sequence:CCGGGTGAACTGGCTGGGATATATTCTCGAGAATATATCCCAGCCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018380
DDX28 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1478s1c1
Sequence:CCGGCCTTGTTCCTTCCCGAGAATTCTCGAGAATTCTCGGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1941s1c1
Sequence:CCGGCCTCATGTGAAACAGACATTTCTCGAGAAATGTCTGTTTCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1863s1c1
Sequence:CCGGGTAGGCCAGTTGCTGAATAAACTCGAGTTTATTCAGCAACTGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-2384s1c1
Sequence:CCGGCCTGGTTCAGAAGATTGAGCTCTCGAGAGCTCAATCTTCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1207s1c1
Sequence:CCGGCGGTGCGAAAGCTCTCGTCTACTCGAGTAGACGAGAGCTTTCGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1209s21c1
Sequence:CCGGGTGCGAAAGCTCTCGTCTAAGCTCGAGCTTAGACGAGAGCTTTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1861s21c1
Sequence:CCGGGTGTAGGCCAGTTGCTGAATACTCGAGTATTCAGCAACTGGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018380.2-2503s21c1
Sequence:CCGGATGCTAGAACAGGGATCTTTCCTCGAGGAAAGATCCCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2434s21c1
Sequence:CCGGGACTAGCATCCTCGGTGAAAGCTCGAGCTTTCACCGAGGATGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2082s21c1
Sequence:CCGGGTGAACTGGCTGGGATATATTCTCGAGAATATATCCCAGCCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018380
DDX28 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1478s1c1
Sequence:CCGGCCTTGTTCCTTCCCGAGAATTCTCGAGAATTCTCGGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1941s1c1
Sequence:CCGGCCTCATGTGAAACAGACATTTCTCGAGAAATGTCTGTTTCACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1863s1c1
Sequence:CCGGGTAGGCCAGTTGCTGAATAAACTCGAGTTTATTCAGCAACTGGCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-2384s1c1
Sequence:CCGGCCTGGTTCAGAAGATTGAGCTCTCGAGAGCTCAATCTTCTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018380.2-1207s1c1
Sequence:CCGGCGGTGCGAAAGCTCTCGTCTACTCGAGTAGACGAGAGCTTTCGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1209s21c1
Sequence:CCGGGTGCGAAAGCTCTCGTCTAAGCTCGAGCTTAGACGAGAGCTTTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-1861s21c1
Sequence:CCGGGTGTAGGCCAGTTGCTGAATACTCGAGTATTCAGCAACTGGCCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018380.2-2503s21c1
Sequence:CCGGATGCTAGAACAGGGATCTTTCCTCGAGGAAAGATCCCTGTTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2434s21c1
Sequence:CCGGGACTAGCATCCTCGGTGAAAGCTCGAGCTTTCACCGAGGATGCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018380.2-2082s21c1
Sequence:CCGGGTGAACTGGCTGGGATATATTCTCGAGAATATATCCCAGCCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028038
VALIDATED
DDX28 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028038.1-1640s1c1
Sequence:CCGGGTTGGCTTGAATCTAGTGCTACTCGAGTAGCACTAGATTCAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1409s1c1
Sequence:CCGGGAAGTGGTTATCAATTACGATCTCGAGATCGTAATTGATAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1148s1c1
Sequence:CCGGGAACTGGTTCAGATCCTCAAACTCGAGTTTGAGGATCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-1265s1c1
Sequence:CCGGGACCACAAGATTCAACATCTACTCGAGTAGATGTTGAATCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-41s1c1
Sequence:CCGGGCGTTAGTAGTACGGTTGCTTCTCGAGAAGCAACCGTACTACTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028038
VALIDATED
DDX28 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028038.1-1640s1c1
Sequence:CCGGGTTGGCTTGAATCTAGTGCTACTCGAGTAGCACTAGATTCAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1409s1c1
Sequence:CCGGGAAGTGGTTATCAATTACGATCTCGAGATCGTAATTGATAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1148s1c1
Sequence:CCGGGAACTGGTTCAGATCCTCAAACTCGAGTTTGAGGATCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-1265s1c1
Sequence:CCGGGACCACAAGATTCAACATCTACTCGAGTAGATGTTGAATCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-41s1c1
Sequence:CCGGGCGTTAGTAGTACGGTTGCTTCTCGAGAAGCAACCGTACTACTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028038
VALIDATED
DDX28 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028038.1-1640s1c1
Sequence:CCGGGTTGGCTTGAATCTAGTGCTACTCGAGTAGCACTAGATTCAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1409s1c1
Sequence:CCGGGAAGTGGTTATCAATTACGATCTCGAGATCGTAATTGATAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028038.1-1148s1c1
Sequence:CCGGGAACTGGTTCAGATCCTCAAACTCGAGTTTGAGGATCTGAACCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-1265s1c1
Sequence:CCGGGACCACAAGATTCAACATCTACTCGAGTAGATGTTGAATCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028038.1-41s1c1
Sequence:CCGGGCGTTAGTAGTACGGTTGCTTCTCGAGAAGCAACCGTACTACTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks