EMAIL THIS PAGE TO A FRIEND

DDX31

DEAD (Asp-Glu-Ala-Asp) box polypeptide 31

62 Gene Product Result for
Synonyms: PPP1R25
Gene ID:
Human(64794) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(227674) DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Rat(311835) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
domestic guinea pig(100726561) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
naked mole-rat(101710327) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
sheep(101119632) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Domestic Rabbit(100359335) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Zebrafish(325248) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
cow(507640) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Horse(100069463) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
domestic cat(101100761) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
dog(480690) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
chicken(427759) DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063681 MISSION® esiRNA esiRNA human DDX31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022779 Rosetta Predictions human pricing
NM_138620 Rosetta Predictions human pricing
NM_001107824 Rosetta Predictions rat pricing
NM_001033294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054016 predicted 202
2 SASI_Hs01_00054017 predicted 1118
3 SASI_Hs01_00054019 predicted 1106
4 SASI_Hs02_00356073 predicted 1659
5 SASI_Hs01_00054020 predicted 772
6 SASI_Hs01_00054021 predicted 737
7 SASI_Hs01_00054022 predicted 953
8 SASI_Hs02_00356074 predicted 696
9 SASI_Hs01_00054024 predicted 706
10 SASI_Hs02_00356075 predicted 1441
11 SASI_Hs01_00054015 predicted 1362
12 SASI_Hs01_00054018 predicted 871
13 SASI_Hs01_00054023 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067089 predicted 196
2 SASI_Hs01_00067090 predicted 1121
3 SASI_Hs01_00067092 predicted 1110
4 SASI_Hs02_00363753 predicted 1651
5 SASI_Hs01_00067093 predicted 779
6 SASI_Hs01_00067094 predicted 736
7 SASI_Hs01_00067095 predicted 949
8 SASI_Hs02_00363754 predicted 696
9 SASI_Hs01_00067097 predicted 706
10 SASI_Hs02_00363755 predicted 1443
11 SASI_Hs01_00067088 predicted 1359
12 SASI_Hs01_00067091 predicted 872
13 SASI_Hs01_00067096 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232635 predicted 1698
2 SASI_Rn02_00232636 predicted 574
3 SASI_Rn02_00232637 predicted 1349
4 SASI_Rn02_00232638 predicted 914
5 SASI_Rn02_00232639 predicted 2033
6 SASI_Rn02_00232640 predicted 328
7 SASI_Rn02_00232641 predicted 809
8 SASI_Rn02_00232642 predicted 939
9 SASI_Rn02_00232643 predicted 366
10 SASI_Rn02_00232644 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149542 predicted 1403
2 SASI_Mm02_00288495 predicted 287
3 SASI_Mm01_00149543 predicted 759
4 SASI_Mm01_00149545 predicted 229
5 SASI_Mm01_00149546 predicted 824
6 SASI_Mm01_00149547 predicted 856
7 SASI_Mm01_00149548 predicted 1611
8 SASI_Mm01_00149549 predicted 1440
9 SASI_Mm01_00149550 predicted 869
10 SASI_Mm01_00149551 predicted 239
11 SASI_Mm01_00149544 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022779
VALIDATED
DDX31 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-880s21c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1793s21c1
Sequence:CCGGATCTGCCTCCATGCGATTAAACTCGAGTTTAATCGCATGGAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022779.7-2799s21c1
Sequence:CCGGACTGCGCCTTTGCCTGAATACCTCGAGGTATTCAGGCAAAGGCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-1246s21c1
Sequence:CCGGGACGCCTGGTGGATCATATAACTCGAGTTATATGATCCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1352s21c1
Sequence:CCGGGGACATCACAGTGATACTTAACTCGAGTTAAGTATCACTGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-880s1c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022779.7-1980s1c1
Sequence:CCGGGCAGAATACATCCACCGGATTCTCGAGAATCCGGTGGATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022779.7-2502s1c1
Sequence:CCGGGCTGAAATCCTACGTTCGGAACTCGAGTTCCGAACGTAGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-706s1c1
Sequence:CCGGCGGTTAGCACAAGTGATAGAACTCGAGTTCTATCACTTGTGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-1027s1c1
Sequence:CCGGCCCTTCAAGCAATGGAGTCAACTCGAGTTGACTCCATTGCTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022779
VALIDATED
DDX31 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-880s21c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1793s21c1
Sequence:CCGGATCTGCCTCCATGCGATTAAACTCGAGTTTAATCGCATGGAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022779.7-2799s21c1
Sequence:CCGGACTGCGCCTTTGCCTGAATACCTCGAGGTATTCAGGCAAAGGCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-1246s21c1
Sequence:CCGGGACGCCTGGTGGATCATATAACTCGAGTTATATGATCCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1352s21c1
Sequence:CCGGGGACATCACAGTGATACTTAACTCGAGTTAAGTATCACTGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-880s1c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022779.7-1980s1c1
Sequence:CCGGGCAGAATACATCCACCGGATTCTCGAGAATCCGGTGGATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022779.7-2502s1c1
Sequence:CCGGGCTGAAATCCTACGTTCGGAACTCGAGTTCCGAACGTAGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-706s1c1
Sequence:CCGGCGGTTAGCACAAGTGATAGAACTCGAGTTCTATCACTTGTGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-1027s1c1
Sequence:CCGGCCCTTCAAGCAATGGAGTCAACTCGAGTTGACTCCATTGCTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022779
VALIDATED
DDX31 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-880s21c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1793s21c1
Sequence:CCGGATCTGCCTCCATGCGATTAAACTCGAGTTTAATCGCATGGAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022779.7-2799s21c1
Sequence:CCGGACTGCGCCTTTGCCTGAATACCTCGAGGTATTCAGGCAAAGGCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022779.7-1246s21c1
Sequence:CCGGGACGCCTGGTGGATCATATAACTCGAGTTATATGATCCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_022779.7-1352s21c1
Sequence:CCGGGGACATCACAGTGATACTTAACTCGAGTTAAGTATCACTGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-880s1c1
Sequence:CCGGCCACAATAAATACGGTCTTAACTCGAGTTAAGACCGTATTTATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022779.7-1980s1c1
Sequence:CCGGGCAGAATACATCCACCGGATTCTCGAGAATCCGGTGGATGTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022779.7-2502s1c1
Sequence:CCGGGCTGAAATCCTACGTTCGGAACTCGAGTTCCGAACGTAGGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-706s1c1
Sequence:CCGGCGGTTAGCACAAGTGATAGAACTCGAGTTCTATCACTTGTGCTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_022779.7-1027s1c1
Sequence:CCGGCCCTTCAAGCAATGGAGTCAACTCGAGTTGACTCCATTGCTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033294
VALIDATED
DDX31 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1025s1c1
Sequence:CCGGCGGCTAGTTGATATCAGTTTGCTCGAGCAAACTGATATCAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1952s1c1
Sequence:CCGGCTAAGAGATGCTCCTAGAAACCTCGAGGTTTCTAGGAGCATCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.1-1986s1c1
Sequence:CCGGGCTGTGAAGAAGGCAAGCTTACTCGAGTAAGCTTGCCTTCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-1003s1c1
Sequence:CCGGCGACACTCACAGAAGGTGTAACTCGAGTTACACCTTCTGTGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2554s1c1
Sequence:CCGGGTGTATTGTATGAGTGTTGTACTCGAGTACAACACTCATACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2459s1c1
Sequence:CCGGGCTTCTTGTGAGATTGCTCATCTCGAGATGAGCAATCTCACAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-332s1c1
Sequence:CCGGCAAGACTTCATCGCTGTTTAACTCGAGTTAAACAGCGATGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033294
VALIDATED
DDX31 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1025s1c1
Sequence:CCGGCGGCTAGTTGATATCAGTTTGCTCGAGCAAACTGATATCAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1952s1c1
Sequence:CCGGCTAAGAGATGCTCCTAGAAACCTCGAGGTTTCTAGGAGCATCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.1-1986s1c1
Sequence:CCGGGCTGTGAAGAAGGCAAGCTTACTCGAGTAAGCTTGCCTTCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-1003s1c1
Sequence:CCGGCGACACTCACAGAAGGTGTAACTCGAGTTACACCTTCTGTGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2554s1c1
Sequence:CCGGGTGTATTGTATGAGTGTTGTACTCGAGTACAACACTCATACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2459s1c1
Sequence:CCGGGCTTCTTGTGAGATTGCTCATCTCGAGATGAGCAATCTCACAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-332s1c1
Sequence:CCGGCAAGACTTCATCGCTGTTTAACTCGAGTTAAACAGCGATGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033294
VALIDATED
DDX31 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 31
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1025s1c1
Sequence:CCGGCGGCTAGTTGATATCAGTTTGCTCGAGCAAACTGATATCAACTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.2-1952s1c1
Sequence:CCGGCTAAGAGATGCTCCTAGAAACCTCGAGGTTTCTAGGAGCATCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033294.1-1986s1c1
Sequence:CCGGGCTGTGAAGAAGGCAAGCTTACTCGAGTAAGCTTGCCTTCTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-1003s1c1
Sequence:CCGGCGACACTCACAGAAGGTGTAACTCGAGTTACACCTTCTGTGAGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2554s1c1
Sequence:CCGGGTGTATTGTATGAGTGTTGTACTCGAGTACAACACTCATACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-2459s1c1
Sequence:CCGGGCTTCTTGTGAGATTGCTCATCTCGAGATGAGCAATCTCACAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033294.1-332s1c1
Sequence:CCGGCAAGACTTCATCGCTGTTTAACTCGAGTTAAACAGCGATGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks