EMAIL THIS PAGE TO A FRIEND

DDX39A

DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A

37 Gene Product Result for
Synonyms: BAT1 BAT1L DDX39 DDXL URH49
UniProtKB ID: O00148, Q8N5M0, Q9BVP6, Q9H5W0
Gene ID:
Human(10212) Summary: This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Feb 2011]
Rat(89827) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
sheep(101123034) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
naked mole-rat(101711053) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
domestic guinea pig(100719647) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
dog(476689) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
domestic cat(101092088) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
cow(614215) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005804 Rosetta Predictions human pricing
NM_053563 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158066 predicted 948
2 SASI_Hs01_00158068 predicted 292
3 SASI_Hs01_00158069 predicted 408
4 SASI_Hs01_00158070 predicted 936
5 SASI_Hs01_00158073 predicted 1060
6 SASI_Hs01_00158074 predicted 1230
7 SASI_Hs02_00340313 predicted 1106
8 SASI_Hs01_00158075 predicted 793
9 SASI_Hs02_00340314 predicted 799
10 SASI_Hs02_00340315 predicted 198
11 SASI_Hs01_00158067 predicted 1108
12 SASI_Hs01_00158071 predicted 632
13 SASI_Hs01_00158072 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073136 predicted 919
2 SASI_Rn01_00073137 predicted 402
3 SASI_Rn02_00266223 predicted 716
4 SASI_Rn01_00073139 predicted 400
5 SASI_Rn01_00073140 predicted 1282
6 SASI_Rn01_00073141 predicted 1036
7 SASI_Rn01_00073142 predicted 689
8 SASI_Rn01_00073143 predicted 1115
9 SASI_Rn01_00073144 predicted 633
10 SASI_Rn01_00073145 predicted 389
11 SASI_Rn01_00073138 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005804
VALIDATED
DDX39A MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-634s21c1
Sequence:CCGGGAATAGGAGCTTCAGCCTAAACTCGAGTTTAGGCTGAAGCTCCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-955s21c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-1153s21c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-943s21c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1153s1c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005804.2-649s1c1
Sequence:CCGGCCTAAAGAATGTGAAGCACTTCTCGAGAAGTGCTTCACATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-955s1c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1313s1c1
Sequence:CCGGGAAGTTAATGTGGCAGAACTTCTCGAGAAGTTCTGCCACATTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-943s1c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005804
VALIDATED
DDX39A MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-634s21c1
Sequence:CCGGGAATAGGAGCTTCAGCCTAAACTCGAGTTTAGGCTGAAGCTCCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-955s21c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-1153s21c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-943s21c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1153s1c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005804.2-649s1c1
Sequence:CCGGCCTAAAGAATGTGAAGCACTTCTCGAGAAGTGCTTCACATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-955s1c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1313s1c1
Sequence:CCGGGAAGTTAATGTGGCAGAACTTCTCGAGAAGTTCTGCCACATTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-943s1c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005804
VALIDATED
DDX39A MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-634s21c1
Sequence:CCGGGAATAGGAGCTTCAGCCTAAACTCGAGTTTAGGCTGAAGCTCCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-955s21c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005804.2-1153s21c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005804.2-943s21c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1153s1c1
Sequence:CCGGGCGAGTCAACATCGTCTTTAACTCGAGTTAAAGACGATGTTGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005804.2-649s1c1
Sequence:CCGGCCTAAAGAATGTGAAGCACTTCTCGAGAAGTGCTTCACATTCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-955s1c1
Sequence:CCGGCCAGGTGATAATCTTCGTCAACTCGAGTTGACGAAGATTATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-1313s1c1
Sequence:CCGGGAAGTTAATGTGGCAGAACTTCTCGAGAAGTTCTGCCACATTAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005804.2-943s1c1
Sequence:CCGGGCTGGAGTTTAACCAGGTGATCTCGAGATCACCTGGTTAAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks