EMAIL THIS PAGE TO A FRIEND

DDX39B

DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B

63 Gene Product Result for
Synonyms: BAT1 D6S81E UAP56
Gene ID:
Human(7919) Summary: This gene encodes a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis during pre-mRNA splicing. The encoded protein is an essential splicing factor required for association of U2 small nuclear ribonucleoprotein with pre-mRNA, and it also plays an important role in mRNA export from the nucleus to the cytoplasm. This gene belongs to a cluster of genes localized in the vicinity of the genes encoding tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. Mutations in this gene may be associated with rheumatoid arthritis. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on both chromosomes 6 and 11. Read-through transcription also occurs between this gene and the upstream ATP6V1G2 (ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2) gene. [provided by RefSeq, Feb 2011]
Mouse(53817) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Rat(114612) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Zebrafish(406249) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39b
cow(540191) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Horse(100146384) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
domestic cat(101083847) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
dog(474839) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
domestic guinea pig(100723839) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
naked mole-rat(101719937) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
sheep(101101929) DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004640 Rosetta Predictions human pricing
NM_080598 Rosetta Predictions human pricing
NM_133300 Rosetta Predictions rat pricing
NM_019693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016556 predicted 1604
2 SASI_Hs01_00016557 predicted 1640
3 SASI_Hs02_00338048 predicted 1838
4 SASI_Hs01_00016558 predicted 1307
5 SASI_Hs01_00016559 predicted 1495
6 SASI_Hs01_00016561 predicted 1614
7 SASI_Hs01_00016562 predicted 1639
8 SASI_Hs01_00016563 predicted 1359
9 SASI_Hs01_00016564 predicted 830
10 SASI_Hs01_00016565 predicted 1674
11 SASI_Hs01_00016560 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246234 predicted 1472
2 SASI_Hs01_00246235 predicted 1513
3 SASI_Hs02_00362334 predicted 1710
4 SASI_Hs01_00246236 predicted 1176
5 SASI_Hs01_00246237 predicted 1366
6 SASI_Hs01_00246239 predicted 1485
7 SASI_Hs01_00246240 predicted 1508
8 SASI_Hs01_00246241 predicted 1233
9 SASI_Hs01_00246242 predicted 697
10 SASI_Hs01_00246243 predicted 1547
11 SASI_Hs01_00246238 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111171 predicted 1199
2 SASI_Rn01_00111172 predicted 465
3 SASI_Rn01_00111173 predicted 301
4 SASI_Rn01_00111174 predicted 273
5 SASI_Rn01_00111175 predicted 967
6 SASI_Rn01_00111176 predicted 1119
7 SASI_Rn01_00111177 predicted 1152
8 SASI_Rn01_00111178 predicted 700
9 SASI_Rn01_00111179 predicted 682
10 SASI_Rn01_00111180 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026325 predicted 1932
2 SASI_Mm01_00026326 predicted 2426
3 SASI_Mm01_00026328 predicted 2031
4 SASI_Mm01_00026329 predicted 2427
5 SASI_Mm01_00026330 predicted 2559
6 SASI_Mm01_00026331 predicted 2099
7 SASI_Mm02_00324790 predicted 1903
8 SASI_Mm01_00026332 predicted 2302
9 SASI_Mm01_00026333 predicted 1537
10 SASI_Mm01_00026334 predicted 2418
11 SASI_Mm01_00026327 predicted 2360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004640
VALIDATED
DDX39B MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004640.4-883s1c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-814s1c1
Sequence:CCGGGAAGAAGAACTGCCCGCATATCTCGAGATATGCGGGCAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1582s1c1
Sequence:CCGGGATAGACATCTCCTCCTACATCTCGAGATGTAGGAGGAGATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1490s1c1
Sequence:CCGGGCTATCACATTTGTGTCCGATCTCGAGATCGGACACAAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1046s1c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1183s21c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1346s21c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1843s21c1
Sequence:CCGGGGATCGCTTTGAGGTCAATATCTCGAGATATTGACCTCAAAGCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1932s21c1
Sequence:CCGGTTTGGAATGTGACCGTCTGTCCTCGAGGACAGACGGTCACATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1159s21c1
Sequence:CCGGCCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004640
VALIDATED
DDX39B MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004640.4-883s1c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-814s1c1
Sequence:CCGGGAAGAAGAACTGCCCGCATATCTCGAGATATGCGGGCAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1582s1c1
Sequence:CCGGGATAGACATCTCCTCCTACATCTCGAGATGTAGGAGGAGATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1490s1c1
Sequence:CCGGGCTATCACATTTGTGTCCGATCTCGAGATCGGACACAAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1046s1c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1183s21c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1346s21c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1843s21c1
Sequence:CCGGGGATCGCTTTGAGGTCAATATCTCGAGATATTGACCTCAAAGCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1932s21c1
Sequence:CCGGTTTGGAATGTGACCGTCTGTCCTCGAGGACAGACGGTCACATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1159s21c1
Sequence:CCGGCCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004640
VALIDATED
DDX39B MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004640.4-883s1c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-814s1c1
Sequence:CCGGGAAGAAGAACTGCCCGCATATCTCGAGATATGCGGGCAGTTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1582s1c1
Sequence:CCGGGATAGACATCTCCTCCTACATCTCGAGATGTAGGAGGAGATGTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1490s1c1
Sequence:CCGGGCTATCACATTTGTGTCCGATCTCGAGATCGGACACAAATGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004640.4-1046s1c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1183s21c1
Sequence:CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1346s21c1
Sequence:CCGGTGCCGCAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1843s21c1
Sequence:CCGGGGATCGCTTTGAGGTCAATATCTCGAGATATTGACCTCAAAGCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1932s21c1
Sequence:CCGGTTTGGAATGTGACCGTCTGTCCTCGAGGACAGACGGTCACATTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004640.5-1159s21c1
Sequence:CCGGCCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019693
VALIDATED
DDX39B MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2432s1c1
Sequence:CCGGGCGTGTGAACATTGCTTTCAACTCGAGTTGAAAGCAATGTTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2435s1c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2088s1c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-1922s1c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2529s1c1
Sequence:CCGGGCCATCACATTTGTGTCAGATCTCGAGATCTGACACAAATGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1898s21c1
Sequence:CCGGTCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1922s21c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2088s21c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2435s21c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019693
VALIDATED
DDX39B MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2432s1c1
Sequence:CCGGGCGTGTGAACATTGCTTTCAACTCGAGTTGAAAGCAATGTTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2435s1c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2088s1c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-1922s1c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2529s1c1
Sequence:CCGGGCCATCACATTTGTGTCAGATCTCGAGATCTGACACAAATGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1898s21c1
Sequence:CCGGTCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1922s21c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2088s21c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2435s21c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019693
VALIDATED
DDX39B MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2432s1c1
Sequence:CCGGGCGTGTGAACATTGCTTTCAACTCGAGTTGAAAGCAATGTTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2435s1c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2088s1c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-1922s1c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019693.2-2529s1c1
Sequence:CCGGGCCATCACATTTGTGTCAGATCTCGAGATCTGACACAAATGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1898s21c1
Sequence:CCGGTCTAGCCCTGGCTCGAAATAACTCGAGTTATTTCGAGCCAGGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-1922s21c1
Sequence:CCGGCCTGAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2088s21c1
Sequence:CCGGCGCAAGTTCATGCAAGATCCTCTCGAGAGGATCTTGCATGAACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019693.2-2435s21c1
Sequence:CCGGTGTGAACATTGCTTTCAACTACTCGAGTAGTTGAAAGCAATGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks