EMAIL THIS PAGE TO A FRIEND

DDX3Y

DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked

222 Gene Product Result for
Synonyms: DBY
UniProtKB ID: O15523, Q8IYV7
Gene ID:
Human(8653) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it has a homolog on the X chromosome. The gene mutation causes male infertility, Sertoli cell-only syndrome or severe hypospermatogenesis, suggesting that this gene plays a key role in the spermatogenic process. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(26900) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Horse(100062250) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
cow(783057) DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702039 Anti-DDX3Y antibody produced in rabbit human, rat, mouse
immunocytochemistry, immunofluorescence, western blot pricing
SAB1411550 Anti-DDX3Y antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4500014 Anti-DDX3Y, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
WH0008653M1 Monoclonal Anti-DDX3Y antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123421 MISSION® esiRNA esiRNA human DDX3Y (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122665 Rosetta Predictions human pricing
NM_004660 Rosetta Predictions human pricing
NM_012008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327156 predicted 809
2 SASI_Hs02_00327157 predicted 2300
3 SASI_Hs02_00327158 predicted 1688
4 SASI_Hs02_00327159 predicted 1319
5 SASI_Hs02_00327160 predicted 1005
6 SASI_Hs02_00327161 predicted 1372
7 SASI_Hs02_00327162 predicted 1311
8 SASI_Hs02_00327163 predicted 616
9 SASI_Hs02_00327164 predicted 1619
10 SASI_Hs02_00327165 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338074 predicted 650
2 SASI_Hs02_00338075 predicted 2144
3 SASI_Hs02_00338076 predicted 1528
4 SASI_Hs01_00024932 predicted 1155
5 SASI_Hs01_00024933 predicted 849
6 SASI_Hs01_00024934 predicted 1212
7 SASI_Hs01_00024935 predicted 1144
8 SASI_Hs01_00024936 predicted 461
9 SASI_Hs01_00024937 predicted 1458
10 SASI_Hs01_00024938 predicted 507
11 SASI_Hs01_00024929 predicted 299
12 SASI_Hs01_00024930 predicted 1107
13 SASI_Hs01_00024931 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049900 predicted 208
2 SASI_Mm01_00049902 predicted 1051
3 SASI_Mm01_00049903 predicted 962
4 SASI_Mm01_00049904 predicted 2040
5 SASI_Mm01_00049905 predicted 1693
6 SASI_Mm01_00049906 predicted 389
7 SASI_Mm01_00049907 predicted 346
8 SASI_Mm01_00049908 predicted 1553
9 SASI_Mm02_00321947 predicted 338
10 SASI_Mm02_00321948 predicted 1108
11 SASI_Mm01_00049901 predicted 1870
12 SASI_Mm01_00049909 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004660
VALIDATED
DDX3Y MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004660.x-4242s1c1
Sequence:CCGGGCCAGCAGTATTCTTCAGTAACTCGAGTTACTGAAGAATACTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004660.x-612s1c1
Sequence:CCGGAGCGATATTGACATGGGAGAACTCGAGTTCTCCCATGTCAATATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-1369s1c1
Sequence:CCGGTAGGTGCAACAGGGAGTGATTCTCGAGAATCACTCCCTGTTGCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-613s1c1
Sequence:CCGGGCGATATTGACATGGGAGAAACTCGAGTTTCTCCCATGTCAATATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-155s1c1
Sequence:CCGGAGGAGCAAGTACAGCGAGCAACTCGAGTTGCTCGCTGTACTTGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004660
VALIDATED
DDX3Y MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004660.x-4242s1c1
Sequence:CCGGGCCAGCAGTATTCTTCAGTAACTCGAGTTACTGAAGAATACTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004660.x-612s1c1
Sequence:CCGGAGCGATATTGACATGGGAGAACTCGAGTTCTCCCATGTCAATATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-1369s1c1
Sequence:CCGGTAGGTGCAACAGGGAGTGATTCTCGAGAATCACTCCCTGTTGCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-613s1c1
Sequence:CCGGGCGATATTGACATGGGAGAAACTCGAGTTTCTCCCATGTCAATATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-155s1c1
Sequence:CCGGAGGAGCAAGTACAGCGAGCAACTCGAGTTGCTCGCTGTACTTGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004660
VALIDATED
DDX3Y MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004660.x-4242s1c1
Sequence:CCGGGCCAGCAGTATTCTTCAGTAACTCGAGTTACTGAAGAATACTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004660.x-612s1c1
Sequence:CCGGAGCGATATTGACATGGGAGAACTCGAGTTCTCCCATGTCAATATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-1369s1c1
Sequence:CCGGTAGGTGCAACAGGGAGTGATTCTCGAGAATCACTCCCTGTTGCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-613s1c1
Sequence:CCGGGCGATATTGACATGGGAGAAACTCGAGTTTCTCCCATGTCAATATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004660.x-155s1c1
Sequence:CCGGAGGAGCAAGTACAGCGAGCAACTCGAGTTGCTCGCTGTACTTGCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012008
VALIDATED
DDX3Y MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-2850s1c1
Sequence:CCGGGCTTTGTTAATTCTGGTCTTTCTCGAGAAAGACCAGAATTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-962s1c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-92s1c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-356s1c1
Sequence:CCGGCGAAATGACTATGATGGTATTCTCGAGAATACCATCATAGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-1606s1c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012008.2-2308s21c1
Sequence:CCGGATTTGTGAGTGAGGATCATTTCTCGAGAAATGATCCTCACTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-1641s21c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-127s21c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-997s21c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012008
VALIDATED
DDX3Y MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-2850s1c1
Sequence:CCGGGCTTTGTTAATTCTGGTCTTTCTCGAGAAAGACCAGAATTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-962s1c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-92s1c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-356s1c1
Sequence:CCGGCGAAATGACTATGATGGTATTCTCGAGAATACCATCATAGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-1606s1c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012008.2-2308s21c1
Sequence:CCGGATTTGTGAGTGAGGATCATTTCTCGAGAAATGATCCTCACTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-1641s21c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-127s21c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-997s21c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012008
VALIDATED
DDX3Y MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-2850s1c1
Sequence:CCGGGCTTTGTTAATTCTGGTCTTTCTCGAGAAAGACCAGAATTAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-962s1c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012008.1-92s1c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-356s1c1
Sequence:CCGGCGAAATGACTATGATGGTATTCTCGAGAATACCATCATAGTCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_012008.1-1606s1c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012008.2-2308s21c1
Sequence:CCGGATTTGTGAGTGAGGATCATTTCTCGAGAAATGATCCTCACTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-1641s21c1
Sequence:CCGGGCCAAGCGATATTGAAGAATACTCGAGTATTCTTCAATATCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-127s21c1
Sequence:CCGGGACCAGCAATTTGTTGGTCTTCTCGAGAAGACCAACAAATTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012008.2-997s21c1
Sequence:CCGGGCTGATACTGTTCAGCAGATTCTCGAGAATCTGCTGAACAGTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks