EMAIL THIS PAGE TO A FRIEND

DDX41

DEAD (Asp-Glu-Ala-Asp) box polypeptide 41

48 Gene Product Result for
Synonyms: ABS
UniProtKB ID: Q9UJV9, B2RDC8, Q96BK6, Q96K05, Q9NT96, Q9NW04
Gene ID:
Human(51428) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Based on studies in Drosophila, the abstrakt gene is widely required during post-transcriptional gene expression. [provided by RefSeq, Jul 2008]
Mouse(72935) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Rat(314336) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
naked mole-rat(101714558) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
domestic guinea pig(100713576) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
sheep(101102307) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Zebrafish(394020) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
cow(505276) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Horse(100058316) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
chicken(427630) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
dog(479274) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
domestic cat(101098434) DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016222 Rosetta Predictions human pricing
NM_134059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161699 predicted 1169
2 SASI_Hs02_00349080 predicted 1319
3 SASI_Hs01_00161700 predicted 487
4 SASI_Hs01_00161702 predicted 711
5 SASI_Hs01_00161703 predicted 366
6 SASI_Hs01_00161704 predicted 1460
7 SASI_Hs01_00161705 predicted 629
8 SASI_Hs01_00161706 predicted 1057
9 SASI_Hs01_00161707 predicted 660
10 SASI_Hs01_00161708 predicted 1831
11 SASI_Hs01_00161701 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136397 predicted 1475
2 SASI_Mm01_00136398 predicted 1365
3 SASI_Mm01_00136399 predicted 1060
4 SASI_Mm01_00136400 predicted 1459
5 SASI_Mm01_00136401 predicted 1480
6 SASI_Mm01_00136403 predicted 1450
7 SASI_Mm01_00136404 predicted 1070
8 SASI_Mm01_00136405 predicted 1438
9 SASI_Mm01_00136406 predicted 1259
10 SASI_Mm02_00339224 predicted 1651
11 SASI_Mm01_00136402 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016222
VALIDATED
DDX41 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1615s1c1
Sequence:CCGGGCCACTACCTTCATCAACAAACTCGAGTTTGTTGATGAAGGTAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1614s1c1
Sequence:CCGGCGCCACTACCTTCATCAACAACTCGAGTTGTTGATGAAGGTAGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1419s1c1
Sequence:CCGGAGACCAGGAGGAACGGACTAACTCGAGTTAGTCCGTTCCTCCTGGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1520s1c1
Sequence:CCGGCCATCCAGCACGTCATCAATTCTCGAGAATTGATGACGTGCTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1552s1c1
Sequence:CCGGGAGGAGATTGAGAACTATGTACTCGAGTACATAGTTCTCAATCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1176s21c1
Sequence:CCGGTGCTAAGAGTGCCCTTGTAAACTCGAGTTTACAAGGGCACTCTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016222.2-1616s21c1
Sequence:CCGGCCACTACCTTCATCAACAAAGCTCGAGCTTTGTTGATGAAGGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1242s21c1
Sequence:CCGGTGTCATCCAGGAGGTAGAATACTCGAGTATTCTACCTCCTGGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1521s21c1
Sequence:CCGGCATCCAGCACGTCATCAATTACTCGAGTAATTGATGACGTGCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016222.2-1935s21c1
Sequence:CCGGCTGCCACCAGTCTACACATACCTCGAGGTATGTGTAGACTGGTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016222
VALIDATED
DDX41 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1615s1c1
Sequence:CCGGGCCACTACCTTCATCAACAAACTCGAGTTTGTTGATGAAGGTAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1614s1c1
Sequence:CCGGCGCCACTACCTTCATCAACAACTCGAGTTGTTGATGAAGGTAGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1419s1c1
Sequence:CCGGAGACCAGGAGGAACGGACTAACTCGAGTTAGTCCGTTCCTCCTGGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1520s1c1
Sequence:CCGGCCATCCAGCACGTCATCAATTCTCGAGAATTGATGACGTGCTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1552s1c1
Sequence:CCGGGAGGAGATTGAGAACTATGTACTCGAGTACATAGTTCTCAATCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1176s21c1
Sequence:CCGGTGCTAAGAGTGCCCTTGTAAACTCGAGTTTACAAGGGCACTCTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016222.2-1616s21c1
Sequence:CCGGCCACTACCTTCATCAACAAAGCTCGAGCTTTGTTGATGAAGGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1242s21c1
Sequence:CCGGTGTCATCCAGGAGGTAGAATACTCGAGTATTCTACCTCCTGGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1521s21c1
Sequence:CCGGCATCCAGCACGTCATCAATTACTCGAGTAATTGATGACGTGCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016222.2-1935s21c1
Sequence:CCGGCTGCCACCAGTCTACACATACCTCGAGGTATGTGTAGACTGGTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016222
VALIDATED
DDX41 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1615s1c1
Sequence:CCGGGCCACTACCTTCATCAACAAACTCGAGTTTGTTGATGAAGGTAGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1614s1c1
Sequence:CCGGCGCCACTACCTTCATCAACAACTCGAGTTGTTGATGAAGGTAGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1419s1c1
Sequence:CCGGAGACCAGGAGGAACGGACTAACTCGAGTTAGTCCGTTCCTCCTGGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1520s1c1
Sequence:CCGGCCATCCAGCACGTCATCAATTCTCGAGAATTGATGACGTGCTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_016222.x-1552s1c1
Sequence:CCGGGAGGAGATTGAGAACTATGTACTCGAGTACATAGTTCTCAATCTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1176s21c1
Sequence:CCGGTGCTAAGAGTGCCCTTGTAAACTCGAGTTTACAAGGGCACTCTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016222.2-1616s21c1
Sequence:CCGGCCACTACCTTCATCAACAAAGCTCGAGCTTTGTTGATGAAGGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1242s21c1
Sequence:CCGGTGTCATCCAGGAGGTAGAATACTCGAGTATTCTACCTCCTGGATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016222.2-1521s21c1
Sequence:CCGGCATCCAGCACGTCATCAATTACTCGAGTAATTGATGACGTGCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016222.2-1935s21c1
Sequence:CCGGCTGCCACCAGTCTACACATACCTCGAGGTATGTGTAGACTGGTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134059
VALIDATED
DDX41 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1046s1c1
Sequence:CCGGCCGCATGATTGACATGGGCTTCTCGAGAAGCCCATGTCAATCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-379s1c1
Sequence:CCGGCCTTGATGTCAGTGAAGGAAACTCGAGTTTCCTTCACTGACATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1260s1c1
Sequence:CCGGGCCAAGATGGTGTACTTGCTTCTCGAGAAGCAAGTACACCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-409s1c1
Sequence:CCGGGCATCACCTATGACGATCCAACTCGAGTTGGATCGTCATAGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-1511s1c1
Sequence:CCGGGCATGTCATCAACTATGACATCTCGAGATGTCATAGTTGATGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134059
VALIDATED
DDX41 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1046s1c1
Sequence:CCGGCCGCATGATTGACATGGGCTTCTCGAGAAGCCCATGTCAATCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-379s1c1
Sequence:CCGGCCTTGATGTCAGTGAAGGAAACTCGAGTTTCCTTCACTGACATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1260s1c1
Sequence:CCGGGCCAAGATGGTGTACTTGCTTCTCGAGAAGCAAGTACACCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-409s1c1
Sequence:CCGGGCATCACCTATGACGATCCAACTCGAGTTGGATCGTCATAGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-1511s1c1
Sequence:CCGGGCATGTCATCAACTATGACATCTCGAGATGTCATAGTTGATGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134059
VALIDATED
DDX41 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1046s1c1
Sequence:CCGGCCGCATGATTGACATGGGCTTCTCGAGAAGCCCATGTCAATCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-379s1c1
Sequence:CCGGCCTTGATGTCAGTGAAGGAAACTCGAGTTTCCTTCACTGACATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-1260s1c1
Sequence:CCGGGCCAAGATGGTGTACTTGCTTCTCGAGAAGCAAGTACACCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134059.1-409s1c1
Sequence:CCGGGCATCACCTATGACGATCCAACTCGAGTTGGATCGTCATAGGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134059.1-1511s1c1
Sequence:CCGGGCATGTCATCAACTATGACATCTCGAGATGTCATAGTTGATGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)