EMAIL THIS PAGE TO A FRIEND

DDX42

DEAD (Asp-Glu-Ala-Asp) box helicase 42

119 Gene Product Result for
Synonyms: DDX42P RHELP RNAHP SF3b125
Gene ID:
Human(11325) Summary: This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(72047) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Rat(303607) DEAD (Asp-Glu-Ala-Asp) box helicase 42
Zebrafish(503932) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
cow(100140430) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Horse(100054076) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
domestic cat(101096859) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
dog(480479) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
chicken(419959) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
sheep(101103580) DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
domestic guinea pig(100716623) DEAD (Asp-Glu-Ala-Asp) box helicase 42
naked mole-rat(101709728) DEAD (Asp-Glu-Ala-Asp) box helicase 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007372 Rosetta Predictions human pricing
NM_203499 Rosetta Predictions human pricing
NM_001107059 Rosetta Predictions rat pricing
NM_028074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343502 predicted 1523
2 SASI_Hs01_00119845 predicted 1460
3 SASI_Hs01_00119846 predicted 2155
4 SASI_Hs01_00119847 predicted 1125
5 SASI_Hs01_00119848 predicted 1506
6 SASI_Hs01_00119849 predicted 3089
7 SASI_Hs01_00119850 predicted 1803
8 SASI_Hs01_00119851 predicted 875
9 SASI_Hs01_00119853 predicted 943
10 SASI_Hs01_00119854 predicted 797
11 SASI_Hs01_00119852 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373437 predicted 1455
2 SASI_Hs01_00087390 predicted 1390
3 SASI_Hs01_00087391 predicted 2083
4 SASI_Hs01_00087392 predicted 1056
5 SASI_Hs01_00087393 predicted 1433
6 SASI_Hs01_00087394 predicted 3019
7 SASI_Hs01_00087395 predicted 1736
8 SASI_Hs01_00087396 predicted 799
9 SASI_Hs01_00087398 predicted 869
10 SASI_Hs01_00087399 predicted 721
11 SASI_Hs01_00087397 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225086 predicted 2438
2 SASI_Rn02_00225087 predicted 1229
3 SASI_Rn02_00225088 predicted 1725
4 SASI_Rn02_00225089 predicted 869
5 SASI_Rn02_00225090 predicted 1120
6 SASI_Rn02_00225091 predicted 939
7 SASI_Rn02_00225092 predicted 2887
8 SASI_Rn02_00225093 predicted 1621
9 SASI_Rn02_00225094 predicted 1214
10 SASI_Rn02_00225095 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099734 predicted 1657
2 SASI_Mm01_00099735 predicted 2372
3 SASI_Mm01_00099736 predicted 2440
4 SASI_Mm01_00099737 predicted 2147
5 SASI_Mm01_00099738 predicted 871
6 SASI_Mm02_00333288 predicted 1520
7 SASI_Mm02_00333289 predicted 1222
8 SASI_Mm01_00099741 predicted 1808
9 SASI_Mm02_00333290 predicted 1228
10 SASI_Mm01_00099743 predicted 1543
11 SASI_Mm01_00099739 predicted 1124
12 SASI_Mm01_00099740 predicted 1651
13 SASI_Mm01_00099742 predicted 1766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028074
VALIDATED
DDX42 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1941s21c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1175s21c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-2577s21c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028074.4-3056s21c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1852s21c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-3058s1c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-1943s1c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1854s1c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-2579s1c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1177s1c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028074
VALIDATED
DDX42 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1941s21c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1175s21c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-2577s21c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028074.4-3056s21c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1852s21c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-3058s1c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-1943s1c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1854s1c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-2579s1c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1177s1c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028074
VALIDATED
DDX42 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1941s21c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1175s21c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-2577s21c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028074.4-3056s21c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028074.4-1852s21c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-3058s1c1
Sequence:CCGGGCGTCGTCAGTCGTCTTTAATCTCGAGATTAAAGACGACTGACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-1943s1c1
Sequence:CCGGCCTTCCATTAAGACAGTCATTCTCGAGAATGACTGTCTTAATGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1854s1c1
Sequence:CCGGGCGAAAGAAACAAGGTTATTTCTCGAGAAATAACCTTGTTTCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028074.2-2579s1c1
Sequence:CCGGCCAGTGACCTACCCTTCTATTCTCGAGAATAGAAGGGTAGGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028074.2-1177s1c1
Sequence:CCGGGCCCATGTTGATTCATATAATCTCGAGATTATATGAATCAACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007372
VALIDATED
DDX42 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-500s21c1
Sequence:GTACCGGAGATTCTAGCAACGTTGATTTCTCGAGAAATCAACGTTGCTAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-3078s21c1
Sequence:CCGGGGATGTGCTAAAGCGTGAAATCTCGAGATTTCACGCTTTAGCACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-2170s21c1
Sequence:CCGGTTCGGAAATCTCGATTCAAAGCTCGAGCTTTGAATCGAGATTTCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1787s21c1
Sequence:CCGGTGCTGAAGAGCTAGCGAATAACTCGAGTTATTCGCTAGCTCTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1320s21c1
Sequence:CCGGCTTCGATCAGTGGCCGTATATCTCGAGATATACGGCCACTGATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1413s1c1
Sequence:CCGGCGACTGATAGATCATGTGAAACTCGAGTTTCACATGATCTATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-2151s1c1
Sequence:CCGGGCAATGCAGAATGCCTGGTTTCTCGAGAAACCAGGCATTCTGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1283s1c1
Sequence:CCGGCCATGCAGAATGTAAGCGGTTCTCGAGAACCGCTTACATTCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1444s1c1
Sequence:CCGGCCAATCTTCAAAGAGTCTCTTCTCGAGAAGAGACTCTTTGAAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007372
VALIDATED
DDX42 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-500s21c1
Sequence:GTACCGGAGATTCTAGCAACGTTGATTTCTCGAGAAATCAACGTTGCTAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-3078s21c1
Sequence:CCGGGGATGTGCTAAAGCGTGAAATCTCGAGATTTCACGCTTTAGCACATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-2170s21c1
Sequence:CCGGTTCGGAAATCTCGATTCAAAGCTCGAGCTTTGAATCGAGATTTCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1787s21c1
Sequence:CCGGTGCTGAAGAGCTAGCGAATAACTCGAGTTATTCGCTAGCTCTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1320s21c1
Sequence:CCGGCTTCGATCAGTGGCCGTATATCTCGAGATATACGGCCACTGATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1413s1c1
Sequence:CCGGCGACTGATAGATCATGTGAAACTCGAGTTTCACATGATCTATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-2151s1c1
Sequence:CCGGGCAATGCAGAATGCCTGGTTTCTCGAGAAACCAGGCATTCTGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1283s1c1
Sequence:CCGGCCATGCAGAATGTAAGCGGTTCTCGAGAACCGCTTACATTCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1444s1c1
Sequence:CCGGCCAATCTTCAAAGAGTCTCTTCTCGAGAAGAGACTCTTTGAAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007372
VALIDATED
DDX42 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 42
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-500s21c1
Sequence:GTACCGGAGATTCTAGCAACGTTGATTTCTCGAGAAATCAACGTTGCTAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-3078s21c1
Sequence:CCGGGGATGTGCTAAAGCGTGAAATCTCGAGATTTCACGCTTTAGCACATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-2170s21c1
Sequence:CCGGTTCGGAAATCTCGATTCAAAGCTCGAGCTTTGAATCGAGATTTCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1787s21c1
Sequence:CCGGTGCTGAAGAGCTAGCGAATAACTCGAGTTATTCGCTAGCTCTTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007372.2-1320s21c1
Sequence:CCGGCTTCGATCAGTGGCCGTATATCTCGAGATATACGGCCACTGATCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1413s1c1
Sequence:CCGGCGACTGATAGATCATGTGAAACTCGAGTTTCACATGATCTATCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-2151s1c1
Sequence:CCGGGCAATGCAGAATGCCTGGTTTCTCGAGAAACCAGGCATTCTGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1283s1c1
Sequence:CCGGCCATGCAGAATGTAAGCGGTTCTCGAGAACCGCTTACATTCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007372.2-1444s1c1
Sequence:CCGGCCAATCTTCAAAGAGTCTCTTCTCGAGAAGAGACTCTTTGAAGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)