EMAIL THIS PAGE TO A FRIEND

DDX43

DEAD (Asp-Glu-Ala-Asp) box polypeptide 43

50 Gene Product Result for
Synonyms: CT13 HAGE
UniProtKB ID: Q9NXZ2, Q6NXR1
Gene ID:
Human(55510) Summary: The protein encoded by this gene is an ATP-dependent RNA helicase in the DEAD-box family and displays tumor-specific expression. [provided by RefSeq, Jul 2008]
Mouse(100048658) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Rat(682138) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
naked mole-rat(101717275) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
domestic guinea pig(100720096) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
sheep(101122797) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Zebrafish(100136871) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
chicken(428637) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
dog(611029) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Horse(100067914) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
cow(100337502) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
domestic cat(101097561) DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018665 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018665 Rosetta Predictions human pricing
XM_001060057 Rosetta Predictions rat pricing
XM_001480923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134599 predicted 715
2 SASI_Hs01_00134600 predicted 1874
3 SASI_Hs01_00134601 predicted 386
4 SASI_Hs01_00134602 predicted 1517
5 SASI_Hs01_00134603 predicted 1454
6 SASI_Hs01_00134604 predicted 669
7 SASI_Hs01_00134605 predicted 280
8 SASI_Hs02_00352173 predicted 1990
9 SASI_Hs01_00134607 predicted 1808
10 SASI_Hs01_00134608 predicted 1095
11 SASI_Hs01_00134606 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295222 predicted 371
2 SASI_Rn02_00295223 predicted 919
3 SASI_Rn02_00295224 predicted 508
4 SASI_Rn02_00295225 predicted 1636
5 SASI_Rn02_00295226 predicted 691
6 SASI_Rn02_00295227 predicted 992
7 SASI_Rn02_00295228 predicted 1043
8 SASI_Rn02_00295229 predicted 586
9 SASI_Rn02_00295230 predicted 1481
10 SASI_Rn02_00295231 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00420771 predicted 1605
2 SASI_Mm02_00420772 predicted 518
3 SASI_Mm02_00420773 predicted 659
4 SASI_Mm02_00420774 predicted 1762
5 SASI_Mm02_00420775 predicted 555
6 SASI_Mm02_00420776 predicted 1005
7 SASI_Mm02_00420777 predicted 686
8 SASI_Mm02_00420778 predicted 1454
9 SASI_Mm02_00420779 predicted 1032
10 SASI_Mm02_00420780 predicted 1427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018665
DDX43 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018665.1-2161s1c1
Sequence:CCGGGACAGAAGTATTGGACATGTTCTCGAGAACATGTCCAATACTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1468s1c1
Sequence:CCGGCCTCGCACAATCTTATTTGAACTCGAGTTCAAATAAGATTGTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1920s1c1
Sequence:CCGGCCATTACAACTTTGACTAGAACTCGAGTTCTAGTCAAAGTTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1146s1c1
Sequence:CCGGCACTTCAAGTAGAAGGAGAATCTCGAGATTCTCCTTCTACTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-662s1c2
Sequence:CCGGCGGCCATTGATAGATTGGGATCTCGAGATCCCAATCTATCAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018665
DDX43 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018665.1-2161s1c1
Sequence:CCGGGACAGAAGTATTGGACATGTTCTCGAGAACATGTCCAATACTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1468s1c1
Sequence:CCGGCCTCGCACAATCTTATTTGAACTCGAGTTCAAATAAGATTGTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1920s1c1
Sequence:CCGGCCATTACAACTTTGACTAGAACTCGAGTTCTAGTCAAAGTTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1146s1c1
Sequence:CCGGCACTTCAAGTAGAAGGAGAATCTCGAGATTCTCCTTCTACTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-662s1c2
Sequence:CCGGCGGCCATTGATAGATTGGGATCTCGAGATCCCAATCTATCAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018665
DDX43 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 43
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018665.1-2161s1c1
Sequence:CCGGGACAGAAGTATTGGACATGTTCTCGAGAACATGTCCAATACTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1468s1c1
Sequence:CCGGCCTCGCACAATCTTATTTGAACTCGAGTTCAAATAAGATTGTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1920s1c1
Sequence:CCGGCCATTACAACTTTGACTAGAACTCGAGTTCTAGTCAAAGTTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-1146s1c1
Sequence:CCGGCACTTCAAGTAGAAGGAGAATCTCGAGATTCTCCTTCTACTTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018665.1-662s1c2
Sequence:CCGGCGGCCATTGATAGATTGGGATCTCGAGATCCCAATCTATCAATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks