EMAIL THIS PAGE TO A FRIEND

DDX46

DEAD (Asp-Glu-Ala-Asp) box polypeptide 46

65 Gene Product Result for
Synonyms: PRPF5 Prp5
UniProtKB ID: Q7L014, O94894, Q96EI0, Q9Y658
Gene ID:
Human(9879) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Mouse(212880) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Rat(245957) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Zebrafish(321948) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
cow(508660) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Horse(100072743) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
domestic cat(101100939) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
dog(474685) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
chicken(416312) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
sheep(101103809) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
domestic guinea pig(100714590) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
naked mole-rat(101711832) DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014829 Rosetta Predictions human pricing
NM_139098 Rosetta Predictions rat pricing
NM_145975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208083 predicted 2885
2 SASI_Hs02_00346373 predicted 1084
3 SASI_Hs01_00208084 predicted 1370
4 SASI_Hs01_00208085 predicted 2517
5 SASI_Hs01_00208086 predicted 834
6 SASI_Hs01_00208087 predicted 1200
7 SASI_Hs01_00208088 predicted 2086
8 SASI_Hs01_00208089 predicted 2406
9 SASI_Hs01_00208090 predicted 1508
10 SASI_Hs02_00346374 predicted 2956
11 SASI_Hs01_00208091 predicted 3039
12 SASI_Hs01_00208092 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079992 predicted 3103
2 SASI_Rn01_00079994 predicted 1353
3 SASI_Rn01_00079995 predicted 1820
4 SASI_Rn01_00079996 predicted 1179
5 SASI_Rn01_00079997 predicted 1085
6 SASI_Rn02_00268468 predicted 1196
7 SASI_Rn01_00080001 predicted 882
8 SASI_Rn02_00268469 predicted 2189
9 SASI_Rn02_00268470 predicted 1093
10 SASI_Rn02_00268471 predicted 1879
11 SASI_Rn01_00079993 predicted 1526
12 SASI_Rn01_00079998 predicted 1747
13 SASI_Rn01_00079999 predicted 1213
14 SASI_Rn01_00080000 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021672 predicted 2327
2 SASI_Mm02_00341474 predicted 2103
3 SASI_Mm02_00341475 predicted 591
4 SASI_Mm01_00021673 predicted 2323
5 SASI_Mm02_00341476 predicted 3225
6 SASI_Mm01_00021674 predicted 1738
7 SASI_Mm01_00021675 predicted 3150
8 SASI_Mm01_00021676 predicted 3098
9 SASI_Mm01_00021677 predicted 1182
10 SASI_Mm01_00021679 predicted 888
11 SASI_Mm01_00021678 predicted 3174
12 SASI_Mm01_00021680 predicted 906
13 SASI_Mm01_00021681 predicted 1612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145975
VALIDATED
DDX46 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1252s21c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1520s21c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145975.3-3724s21c1
Sequence:CCGGTAGTCAAGCCCTGGCTTATAACTCGAGTTATAAGCCAGGGCTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-2595s21c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1459s1c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3234s1c1
Sequence:CCGGGTGTATTGTAAAGTAAGGCTTCTCGAGAAGCCTTACTTTACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-2534s1c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1191s1c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3346s1c1
Sequence:CCGGCCATCTACATTAGACCTGTTTCTCGAGAAACAGGTCTAATGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145975
VALIDATED
DDX46 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1252s21c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1520s21c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145975.3-3724s21c1
Sequence:CCGGTAGTCAAGCCCTGGCTTATAACTCGAGTTATAAGCCAGGGCTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-2595s21c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1459s1c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3234s1c1
Sequence:CCGGGTGTATTGTAAAGTAAGGCTTCTCGAGAAGCCTTACTTTACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-2534s1c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1191s1c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3346s1c1
Sequence:CCGGCCATCTACATTAGACCTGTTTCTCGAGAAACAGGTCTAATGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145975
VALIDATED
DDX46 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1252s21c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-1520s21c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145975.3-3724s21c1
Sequence:CCGGTAGTCAAGCCCTGGCTTATAACTCGAGTTATAAGCCAGGGCTTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145975.3-2595s21c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1459s1c1
Sequence:CCGGGCTGGCTTTACAAATCACTAACTCGAGTTAGTGATTTGTAAAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3234s1c1
Sequence:CCGGGTGTATTGTAAAGTAAGGCTTCTCGAGAAGCCTTACTTTACAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-2534s1c1
Sequence:CCGGGAACAGATTGAAAGCATGTTTCTCGAGAAACATGCTTTCAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-1191s1c1
Sequence:CCGGGCCCGAAACCAATTAAATCATCTCGAGATGATTTAATTGGTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193697    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145975.2-3346s1c1
Sequence:CCGGCCATCTACATTAGACCTGTTTCTCGAGAAACAGGTCTAATGTAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014829
VALIDATED
DDX46 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1957s21c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-865s21c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-3175s21c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1357s21c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3154s1c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014829.x-1933s1c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-841s1c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-1333s1c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3266s1c1
Sequence:CCGGCCTGTGCTGGTCTATGATGTACTCGAGTACATCATAGACCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014829
VALIDATED
DDX46 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1957s21c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-865s21c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-3175s21c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1357s21c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3154s1c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014829.x-1933s1c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-841s1c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-1333s1c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3266s1c1
Sequence:CCGGCCTGTGCTGGTCTATGATGTACTCGAGTACATCATAGACCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014829
VALIDATED
DDX46 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1957s21c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-865s21c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-3175s21c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014829.2-1357s21c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3154s1c1
Sequence:CCGGGCAGAAATCACCAGGCTCATACTCGAGTATGAGCCTGGTGATTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014829.x-1933s1c1
Sequence:CCGGGTGATTGTGATTGAAGAAGAACTCGAGTTCTTCTTCAATCACAATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-841s1c1
Sequence:CCGGGAAGAAGTGAAAGAGGAAGTACTCGAGTACTTCCTCTTTCACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-1333s1c1
Sequence:CCGGCCCATCCAAACCCAAGCTATTCTCGAGAATAGCTTGGGTTTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014829.x-3266s1c1
Sequence:CCGGCCTGTGCTGGTCTATGATGTACTCGAGTACATCATAGACCAGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks