EMAIL THIS PAGE TO A FRIEND

DDX47

DEAD (Asp-Glu-Ala-Asp) box polypeptide 47

66 Gene Product Result for
Synonyms: E4-DBP HQ0256 MSTP162 RRP3
UniProtKB ID: Q9H0S4, B3KXP4, G5E955, Q96GM0, Q96NV8, Q9UI98
Gene ID:
Human(51202) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67755) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Rat(297685) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
naked mole-rat(101697827) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
domestic guinea pig(100729640) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
sheep(101111007) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Domestic Rabbit(100354028) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
chicken(417959) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
dog(477691) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Horse(100063569) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
cow(534721) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
domestic cat(101092946) DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36440 Anti-DDX47 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, canine, horse, rabbit, human, zebrafish, bovine, guinea pig, rat,
western blot pricing
AV41210 Anti-DDX47 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, human, horse, canine, mouse, rat, guinea pig, rabbit
immunohistochemistry, western blot pricing
SAB1407457 Anti-DDX47 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA014855 Anti-DDX47 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV41211 Anti-DDX47 antibody produced in rabbit affinity isolated antibody horse, mouse, bovine, human, canine, guinea pig, rabbit
western blot pricing
SAB2100556 Anti-DDX47 antibody produced in rabbit affinity isolated antibody human, canine, horse, mouse, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218471 MISSION® esiRNA esiRNA targeting human DDX47 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016355 Rosetta Predictions human pricing
NM_201224 Rosetta Predictions human pricing
NM_001015005 Rosetta Predictions rat pricing
NM_026360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349319 predicted 550
2 SASI_Hs01_00160701 predicted 1467
3 SASI_Hs01_00160702 predicted 548
4 SASI_Hs01_00160703 predicted 521
5 SASI_Hs01_00160704 predicted 538
6 SASI_Hs01_00160705 predicted 1330
7 SASI_Hs01_00160706 predicted 420
8 SASI_Hs02_00349320 predicted 415
9 SASI_Hs01_00160707 predicted 389
10 SASI_Hs02_00349321 predicted 445
11 SASI_Hs01_00160708 predicted 1128
12 SASI_Hs01_00160709 predicted 519
13 SASI_Hs01_00160710 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372896 predicted 547
2 SASI_Hs01_00088514 predicted 1321
3 SASI_Hs01_00088515 predicted 544
4 SASI_Hs01_00088516 predicted 520
5 SASI_Hs01_00088517 predicted 534
6 SASI_Hs01_00088518 predicted 1180
7 SASI_Hs01_00088519 predicted 415
8 SASI_Hs02_00372897 predicted 418
9 SASI_Hs01_00088520 predicted 386
10 SASI_Hs02_00372898 predicted 442
11 SASI_Hs01_00088521 predicted 977
12 SASI_Hs01_00088522 predicted 525
13 SASI_Hs01_00088523 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201921 predicted 428
2 SASI_Rn02_00201922 predicted 1030
3 SASI_Rn02_00201923 predicted 1095
4 SASI_Rn02_00201924 predicted 1238
5 SASI_Rn02_00201925 predicted 531
6 SASI_Rn02_00201926 predicted 654
7 SASI_Rn02_00201927 predicted 455
8 SASI_Rn02_00201928 predicted 1029
9 SASI_Rn02_00201929 predicted 915
10 SASI_Rn02_00201930 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030221 predicted 442
2 SASI_Mm01_00030222 predicted 771
3 SASI_Mm01_00030223 predicted 1038
4 SASI_Mm02_00330082 predicted 857
5 SASI_Mm01_00030225 predicted 547
6 SASI_Mm01_00030226 predicted 1052
7 SASI_Mm01_00030227 predicted 288
8 SASI_Mm01_00030228 predicted 954
9 SASI_Mm01_00030229 predicted 323
10 SASI_Mm01_00030230 predicted 1028
11 SASI_Mm01_00030224 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016355
VALIDATED
DDX47 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-1408s1c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-937s1c1
Sequence:CCGGCCTTAATAAGTTTAAGGCCAACTCGAGTTGGCCTTAAACTTATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-161s1c1
Sequence:CCGGCCCACCAAGATCCAGATTGAACTCGAGTTCAATCTGGATCTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-553s1c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-677s1c1
Sequence:CCGGGCTCTGAAGAATCCTGTGAAACTCGAGTTTCACAGGATTCTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-1372s21c1
Sequence:CCGGGAAGCGGAAAGGCCGTTAATCCTCGAGGATTAACGGCCTTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-193s21c1
Sequence:CCGGGGCCTTACAAGGTCGTGATATCTCGAGATATCACGACCTTGTAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-771s21c1
Sequence:CCGGAGGATACCTACCTGGTTTATACTCGAGTATAAACCAGGTAGGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016355.3-1408s21c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-553s21c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016355
VALIDATED
DDX47 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-1408s1c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-937s1c1
Sequence:CCGGCCTTAATAAGTTTAAGGCCAACTCGAGTTGGCCTTAAACTTATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-161s1c1
Sequence:CCGGCCCACCAAGATCCAGATTGAACTCGAGTTCAATCTGGATCTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-553s1c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-677s1c1
Sequence:CCGGGCTCTGAAGAATCCTGTGAAACTCGAGTTTCACAGGATTCTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-1372s21c1
Sequence:CCGGGAAGCGGAAAGGCCGTTAATCCTCGAGGATTAACGGCCTTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-193s21c1
Sequence:CCGGGGCCTTACAAGGTCGTGATATCTCGAGATATCACGACCTTGTAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-771s21c1
Sequence:CCGGAGGATACCTACCTGGTTTATACTCGAGTATAAACCAGGTAGGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016355.3-1408s21c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-553s21c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016355
VALIDATED
DDX47 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-1408s1c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-937s1c1
Sequence:CCGGCCTTAATAAGTTTAAGGCCAACTCGAGTTGGCCTTAAACTTATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-161s1c1
Sequence:CCGGCCCACCAAGATCCAGATTGAACTCGAGTTCAATCTGGATCTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016355.3-553s1c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016355.3-677s1c1
Sequence:CCGGGCTCTGAAGAATCCTGTGAAACTCGAGTTTCACAGGATTCTTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-1372s21c1
Sequence:CCGGGAAGCGGAAAGGCCGTTAATCCTCGAGGATTAACGGCCTTTCCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-193s21c1
Sequence:CCGGGGCCTTACAAGGTCGTGATATCTCGAGATATCACGACCTTGTAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-771s21c1
Sequence:CCGGAGGATACCTACCTGGTTTATACTCGAGTATAAACCAGGTAGGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016355.3-1408s21c1
Sequence:CCGGCGAGTTCTGCTGTTCTGTAAACTCGAGTTTACAGAACAGCAGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016355.3-553s21c1
Sequence:CCGGCCGAATACTGAATATGGATTTCTCGAGAAATCCATATTCAGTATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026360
VALIDATED
DDX47 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1473s1c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-107s1c1
Sequence:CCGGCCTGGGTGTTACGGATGTATTCTCGAGAATACATCCGTAACACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-678s1c1
Sequence:CCGGGCTCTTAAGAACCCTGTGAAACTCGAGTTTCACAGGGTTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1157s1c1
Sequence:CCGGCGAGCACTTGATTGGAAAGAACTCGAGTTCTTTCCAATCAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-554s1c1
Sequence:CCGGCCGGATACTGAACATGGATTTCTCGAGAAATCCATGTTCAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-195s21c1
Sequence:CCGGCCTTGCAAGGTCGTGATATTACTCGAGTAATATCACGACCTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-925s21c1
Sequence:CCGGGCGCCTCGGATCCCTTAATAACTCGAGTTATTAAGGGATCCGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1015s21c1
Sequence:CCGGTGTGGATGTAGTGGTCAATTTCTCGAGAAATTGACCACTACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026360.2-1472s21c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1044s21c1
Sequence:CCGGCGACTCATTCTAAGGATTATACTCGAGTATAATCCTTAGAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026360
VALIDATED
DDX47 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1473s1c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-107s1c1
Sequence:CCGGCCTGGGTGTTACGGATGTATTCTCGAGAATACATCCGTAACACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-678s1c1
Sequence:CCGGGCTCTTAAGAACCCTGTGAAACTCGAGTTTCACAGGGTTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1157s1c1
Sequence:CCGGCGAGCACTTGATTGGAAAGAACTCGAGTTCTTTCCAATCAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-554s1c1
Sequence:CCGGCCGGATACTGAACATGGATTTCTCGAGAAATCCATGTTCAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-195s21c1
Sequence:CCGGCCTTGCAAGGTCGTGATATTACTCGAGTAATATCACGACCTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-925s21c1
Sequence:CCGGGCGCCTCGGATCCCTTAATAACTCGAGTTATTAAGGGATCCGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1015s21c1
Sequence:CCGGTGTGGATGTAGTGGTCAATTTCTCGAGAAATTGACCACTACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026360.2-1472s21c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1044s21c1
Sequence:CCGGCGACTCATTCTAAGGATTATACTCGAGTATAATCCTTAGAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026360
VALIDATED
DDX47 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1473s1c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-107s1c1
Sequence:CCGGCCTGGGTGTTACGGATGTATTCTCGAGAATACATCCGTAACACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026360.1-678s1c1
Sequence:CCGGGCTCTTAAGAACCCTGTGAAACTCGAGTTTCACAGGGTTCTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-1157s1c1
Sequence:CCGGCGAGCACTTGATTGGAAAGAACTCGAGTTCTTTCCAATCAAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026360.1-554s1c1
Sequence:CCGGCCGGATACTGAACATGGATTTCTCGAGAAATCCATGTTCAGTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-195s21c1
Sequence:CCGGCCTTGCAAGGTCGTGATATTACTCGAGTAATATCACGACCTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-925s21c1
Sequence:CCGGGCGCCTCGGATCCCTTAATAACTCGAGTTATTAAGGGATCCGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1015s21c1
Sequence:CCGGTGTGGATGTAGTGGTCAATTTCTCGAGAAATTGACCACTACATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026360.2-1472s21c1
Sequence:CCGGCCTCGGGATTGCAGTGTCATTCTCGAGAATGACACTGCAATCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026360.2-1044s21c1
Sequence:CCGGCGACTCATTCTAAGGATTATACTCGAGTATAATCCTTAGAATGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks