EMAIL THIS PAGE TO A FRIEND

DDX49

DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

Synonyms: R27090_2
UniProtKB ID: Q9Y6V7, Q53FJ1
Gene ID:
Mouse(234374) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Rat(290660) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Zebrafish(386632) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
chicken(420116) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
cow(533809) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Horse(100069624) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
domestic cat(101089924) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
dog(484814) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
sheep(101107191) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
domestic guinea pig(100714647) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
naked mole-rat(101707019) DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130791 MISSION® esiRNA esiRNA human DDX49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019070 Rosetta Predictions human pricing
NM_001115023 Rosetta Predictions rat pricing
XM_214290 Rosetta Predictions rat pricing
NM_001024922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072410 predicted 998
2 SASI_Hs01_00072411 predicted 210
3 SASI_Hs01_00072412 predicted 845
4 SASI_Hs01_00072413 predicted 1139
5 SASI_Hs01_00072414 predicted 946
6 SASI_Hs01_00072415 predicted 250
7 SASI_Hs01_00072416 predicted 883
8 SASI_Hs01_00072417 predicted 296
9 SASI_Hs01_00072418 predicted 1346
10 SASI_Hs01_00072419 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252403 predicted 911
2 SASI_Rn02_00252404 predicted 438
3 SASI_Rn02_00252405 predicted 810
4 SASI_Rn02_00252406 predicted 1314
5 SASI_Rn02_00252407 predicted 316
6 SASI_Rn02_00252408 predicted 497
7 SASI_Rn02_00252409 predicted 515
8 SASI_Rn02_00252410 predicted 569
9 SASI_Rn02_00252411 predicted 672
10 SASI_Rn02_00252412 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173281 predicted 898
2 SASI_Rn01_00173282 predicted 419
3 SASI_Rn01_00173283 predicted 795
4 SASI_Rn01_00173284 predicted 245
5 SASI_Rn01_00173285 predicted 303
6 SASI_Rn01_00173286 predicted 664
7 SASI_Rn01_00173287 predicted 491
8 SASI_Rn01_00173288 predicted 508
9 SASI_Rn01_00173289 predicted 794
10 SASI_Rn01_00173290 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183956 predicted 557
2 SASI_Mm01_00183957 predicted 651
3 SASI_Mm01_00183958 predicted 313
4 SASI_Mm01_00183959 predicted 259
5 SASI_Mm01_00183960 predicted 799
6 SASI_Mm01_00183961 predicted 303
7 SASI_Mm01_00183962 predicted 1649
8 SASI_Mm01_00183963 predicted 419
9 SASI_Mm01_00183964 predicted 1776
10 SASI_Mm01_00183965 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019070
VALIDATED
DDX49 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-849s21c1
Sequence:CCGGGTGCATGATGCTGCGCAAATTCTCGAGAATTTGCGCAGCATCATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-795s21c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019070.3-1531s21c1
Sequence:CCGGAGTCCTTGACTCGTCCATGGACTCGAGTCCATGGACGAGTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-351s21c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-1146s21c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-795s1c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-1146s1c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-351s1c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-999s1c1
Sequence:CCGGCCCTACGGTACAGGTGGTCATCTCGAGATGACCACCTGTACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019070.3-96s1c1
Sequence:CCGGCGTGGAACAATGTCGGCAGCTCTCGAGAGCTGCCGACATTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019070
VALIDATED
DDX49 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-849s21c1
Sequence:CCGGGTGCATGATGCTGCGCAAATTCTCGAGAATTTGCGCAGCATCATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-795s21c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019070.3-1531s21c1
Sequence:CCGGAGTCCTTGACTCGTCCATGGACTCGAGTCCATGGACGAGTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-351s21c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-1146s21c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-795s1c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-1146s1c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-351s1c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-999s1c1
Sequence:CCGGCCCTACGGTACAGGTGGTCATCTCGAGATGACCACCTGTACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019070.3-96s1c1
Sequence:CCGGCGTGGAACAATGTCGGCAGCTCTCGAGAGCTGCCGACATTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019070
VALIDATED
DDX49 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-849s21c1
Sequence:CCGGGTGCATGATGCTGCGCAAATTCTCGAGAATTTGCGCAGCATCATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-795s21c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019070.3-1531s21c1
Sequence:CCGGAGTCCTTGACTCGTCCATGGACTCGAGTCCATGGACGAGTCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_019070.3-351s21c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019070.3-1146s21c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-795s1c1
Sequence:CCGGCGAGGACTGGTCCATTATCATCTCGAGATGATAATGGACCAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-1146s1c1
Sequence:CCGGCGAGGAGCAGATCAAGAAGAACTCGAGTTCTTCTTGATCTGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-351s1c1
Sequence:CCGGGCTGAAAGACTGCATCATCGTCTCGAGACGATGATGCAGTCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_019070.3-999s1c1
Sequence:CCGGCCCTACGGTACAGGTGGTCATCTCGAGATGACCACCTGTACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019070.3-96s1c1
Sequence:CCGGCGTGGAACAATGTCGGCAGCTCTCGAGAGCTGCCGACATTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024922
VALIDATED
DDX49 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024922.2-1667s1c1
Sequence:CCGGCGTAGAAATGTAACCTGGGTACTCGAGTACCCAGGTTACATTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-804s1c1
Sequence:CCGGCCTTTGTATGATGCTTCGAAACTCGAGTTTCGAAGCATCATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-1074s1c1
Sequence:CCGGGCAGTATGATATCCACCTGTTCTCGAGAACAGGTGGATATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-420s1c1
Sequence:CCGGGCGCAGTTCCAACACTTTCAACTCGAGTTGAAAGTGTTGGAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-902s1c1
Sequence:CCGGCCAGCATCTATCGGATTCTTACTCGAGTAAGAATCCGATAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024922
VALIDATED
DDX49 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024922.2-1667s1c1
Sequence:CCGGCGTAGAAATGTAACCTGGGTACTCGAGTACCCAGGTTACATTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-804s1c1
Sequence:CCGGCCTTTGTATGATGCTTCGAAACTCGAGTTTCGAAGCATCATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-1074s1c1
Sequence:CCGGGCAGTATGATATCCACCTGTTCTCGAGAACAGGTGGATATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-420s1c1
Sequence:CCGGGCGCAGTTCCAACACTTTCAACTCGAGTTGAAAGTGTTGGAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-902s1c1
Sequence:CCGGCCAGCATCTATCGGATTCTTACTCGAGTAAGAATCCGATAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024922
VALIDATED
DDX49 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024922.2-1667s1c1
Sequence:CCGGCGTAGAAATGTAACCTGGGTACTCGAGTACCCAGGTTACATTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-804s1c1
Sequence:CCGGCCTTTGTATGATGCTTCGAAACTCGAGTTTCGAAGCATCATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-1074s1c1
Sequence:CCGGGCAGTATGATATCCACCTGTTCTCGAGAACAGGTGGATATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-420s1c1
Sequence:CCGGGCGCAGTTCCAACACTTTCAACTCGAGTTGAAAGTGTTGGAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024922.2-902s1c1
Sequence:CCGGCCAGCATCTATCGGATTCTTACTCGAGTAAGAATCCGATAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks