EMAIL THIS PAGE TO A FRIEND

DDX4

DEAD (Asp-Glu-Ala-Asp) box polypeptide 4

77 Gene Product Result for
Synonyms: VASA
Gene ID:
Human(54514) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(13206) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Rat(310090) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
chicken(395447) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
dog(487211) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
cow(493725) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
domestic cat(101089575) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
sheep(100568293) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Domestic Rabbit(100348576) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
domestic guinea pig(100724852) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
naked mole-rat(101704550) DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024415 Rosetta Predictions human pricing
NM_001077647 Rosetta Predictions rat pricing
NM_010029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356717 predicted 227
2 SASI_Hs01_00216463 predicted 923
3 SASI_Hs01_00216464 predicted 351
4 SASI_Hs01_00216465 predicted 1574
5 SASI_Hs01_00216466 predicted 1718
6 SASI_Hs01_00216468 predicted 2025
7 SASI_Hs01_00216469 predicted 1249
8 SASI_Hs01_00216470 predicted 1707
9 SASI_Hs01_00216471 predicted 430
10 SASI_Hs01_00216472 predicted 1193
11 SASI_Hs01_00216467 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207702 predicted 1452
2 SASI_Rn02_00207703 predicted 1946
3 SASI_Rn02_00207704 predicted 2484
4 SASI_Rn02_00207705 predicted 2118
5 SASI_Rn02_00207706 predicted 1526
6 SASI_Rn02_00207707 predicted 1353
7 SASI_Rn02_00207708 predicted 1598
8 SASI_Rn02_00207709 predicted 1278
9 SASI_Rn02_00207710 predicted 1420
10 SASI_Rn02_00207711 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196037 predicted 1579
2 SASI_Mm01_00196039 predicted 1608
3 SASI_Mm01_00196040 predicted 1267
4 SASI_Mm01_00196041 predicted 1492
5 SASI_Mm01_00196042 predicted 1859
6 SASI_Mm01_00196043 predicted 1184
7 SASI_Mm01_00196044 predicted 1010
8 SASI_Mm01_00196045 predicted 1335
9 SASI_Mm02_00317679 predicted 660
10 SASI_Mm01_00196046 predicted 873
11 SASI_Mm01_00196038 predicted 2139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010029
DDX4 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-528s1c1
Sequence:CCGGGCAGCAAGTGATTCAGGCAATCTCGAGATTGCCTGAATCACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1732s1c1
Sequence:CCGGGCCCAGTTCTTGTTGCTACTTCTCGAGAAGTAGCAACAAGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010029.1-2292s1c1
Sequence:CCGGGCCAGCTTCATTGATTAGTTACTCGAGTAACTAATCAATGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-366s1c1
Sequence:CCGGCAAGATGGAAACGATTCAGAACTCGAGTTCTGAATCGTTTCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1550s1c1
Sequence:CCGGGCTTGTTGAGATTCTACGAAACTCGAGTTTCGTAGAATCTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010029
DDX4 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-528s1c1
Sequence:CCGGGCAGCAAGTGATTCAGGCAATCTCGAGATTGCCTGAATCACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1732s1c1
Sequence:CCGGGCCCAGTTCTTGTTGCTACTTCTCGAGAAGTAGCAACAAGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010029.1-2292s1c1
Sequence:CCGGGCCAGCTTCATTGATTAGTTACTCGAGTAACTAATCAATGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-366s1c1
Sequence:CCGGCAAGATGGAAACGATTCAGAACTCGAGTTCTGAATCGTTTCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1550s1c1
Sequence:CCGGGCTTGTTGAGATTCTACGAAACTCGAGTTTCGTAGAATCTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010029
DDX4 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-528s1c1
Sequence:CCGGGCAGCAAGTGATTCAGGCAATCTCGAGATTGCCTGAATCACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1732s1c1
Sequence:CCGGGCCCAGTTCTTGTTGCTACTTCTCGAGAAGTAGCAACAAGAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010029.1-2292s1c1
Sequence:CCGGGCCAGCTTCATTGATTAGTTACTCGAGTAACTAATCAATGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-366s1c1
Sequence:CCGGCAAGATGGAAACGATTCAGAACTCGAGTTCTGAATCGTTTCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010029.1-1550s1c1
Sequence:CCGGGCTTGTTGAGATTCTACGAAACTCGAGTTTCGTAGAATCTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019039
DDX4 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-242s1c1
Sequence:CCGGGCGAGATAATACATCCACAATCTCGAGATTGTGGATGTATTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-795s1c1
Sequence:CCGGGCACATTATCAGACAGGCATACTCGAGTATGCCTGTCTGATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-313s1c1
Sequence:CCGGGCAGGTTTGAAGATGGTGATACTCGAGTATCACCATCTTCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1869s1c1
Sequence:CCGGCCTTCTACCATTGATGAATATCTCGAGATATTCATCAATGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1607s1c1
Sequence:CCGGGCTCGTTGAAATTCTGCGAAACTCGAGTTTCGCAGAATTTCAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019039
DDX4 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-242s1c1
Sequence:CCGGGCGAGATAATACATCCACAATCTCGAGATTGTGGATGTATTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-795s1c1
Sequence:CCGGGCACATTATCAGACAGGCATACTCGAGTATGCCTGTCTGATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-313s1c1
Sequence:CCGGGCAGGTTTGAAGATGGTGATACTCGAGTATCACCATCTTCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1869s1c1
Sequence:CCGGCCTTCTACCATTGATGAATATCTCGAGATATTCATCAATGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1607s1c1
Sequence:CCGGGCTCGTTGAAATTCTGCGAAACTCGAGTTTCGCAGAATTTCAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019039
DDX4 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-242s1c1
Sequence:CCGGGCGAGATAATACATCCACAATCTCGAGATTGTGGATGTATTATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-795s1c1
Sequence:CCGGGCACATTATCAGACAGGCATACTCGAGTATGCCTGTCTGATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-313s1c1
Sequence:CCGGGCAGGTTTGAAGATGGTGATACTCGAGTATCACCATCTTCAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1869s1c1
Sequence:CCGGCCTTCTACCATTGATGAATATCTCGAGATATTCATCAATGGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019039.1-1607s1c1
Sequence:CCGGGCTCGTTGAAATTCTGCGAAACTCGAGTTTCGCAGAATTTCAACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks