EMAIL THIS PAGE TO A FRIEND

DDX50

DEAD (Asp-Glu-Ala-Asp) box polypeptide 50

109 Gene Product Result for
Synonyms: GU2 GUB RH-II/GuB mcdrh
UniProtKB ID: Q9BQ39, Q5VX37, Q8WV76, Q9BWI8
Gene ID:
Human(79009) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Mouse(94213) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Rat(361848) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
sheep(101106650) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Domestic Rabbit(100346393) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
domestic guinea pig(100722648) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
naked mole-rat(101704536) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
chicken(768898) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
cow(534331) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Horse(100063192) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
domestic cat(101092053) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
dog(612801) DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024045 Rosetta Predictions human pricing
NM_001013198 Rosetta Predictions rat pricing
XM_001058418 Rosetta Predictions rat pricing
XM_001058536 Rosetta Predictions rat pricing
XM_001074918 Rosetta Predictions rat pricing
XM_001074964 Rosetta Predictions rat pricing
NM_053183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151949 predicted 856
2 SASI_Hs01_00151951 predicted 1093
3 SASI_Hs01_00151953 predicted 1261
4 SASI_Hs02_00356487 predicted 2022
5 SASI_Hs01_00151954 predicted 1358
6 SASI_Hs02_00356488 predicted 1452
7 SASI_Hs01_00151955 predicted 1939
8 SASI_Hs01_00151956 predicted 1655
9 SASI_Hs01_00151957 predicted 1819
10 SASI_Hs02_00356489 predicted 2081
11 SASI_Hs01_00151950 predicted 1295
12 SASI_Hs01_00151952 predicted 1811
13 SASI_Hs01_00151958 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200962 predicted 565
2 SASI_Rn02_00200963 predicted 1086
3 SASI_Rn02_00200964 predicted 693
4 SASI_Rn02_00200965 predicted 1372
5 SASI_Rn02_00200966 predicted 1022
6 SASI_Rn02_00200967 predicted 740
7 SASI_Rn02_00200968 predicted 845
8 SASI_Rn02_00200969 predicted 322
9 SASI_Rn02_00200970 predicted 1643
10 SASI_Rn02_00200971 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289653 predicted 538
2 SASI_Rn02_00289654 predicted 262
3 SASI_Rn02_00289655 predicted 810
4 SASI_Rn02_00289656 predicted 790
5 SASI_Rn02_00289657 predicted 1265
6 SASI_Rn02_00289658 predicted 880
7 SASI_Rn02_00289659 predicted 862
8 SASI_Rn02_00289660 predicted 957
9 SASI_Rn02_00289661 predicted 522
10 SASI_Rn02_00289662 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290059 predicted 559
2 SASI_Rn02_00290060 predicted 692
3 SASI_Rn02_00290061 predicted 1371
4 SASI_Rn02_00290062 predicted 1020
5 SASI_Rn02_00290063 predicted 748
6 SASI_Rn02_00290064 predicted 840
7 SASI_Rn02_00290065 predicted 314
8 SASI_Rn02_00290066 predicted 1640
9 SASI_Rn02_00290067 predicted 1284
10 SASI_Rn02_00290068 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347732 predicted 532
2 SASI_Rn02_00347733 predicted 837
3 SASI_Rn02_00347734 predicted 816
4 SASI_Rn02_00347735 predicted 790
5 SASI_Rn02_00347736 predicted 884
6 SASI_Rn02_00347737 predicted 862
7 SASI_Rn02_00347738 predicted 706
8 SASI_Rn02_00347739 predicted 960
9 SASI_Rn02_00347740 predicted 475
10 SASI_Rn02_00347741 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347922 predicted 1645
2 SASI_Rn02_00347923 predicted 1950
3 SASI_Rn02_00347924 predicted 1927
4 SASI_Rn02_00347925 predicted 1912
5 SASI_Rn02_00347926 predicted 1995
6 SASI_Rn02_00347927 predicted 1972
7 SASI_Rn02_00347928 predicted 1825
8 SASI_Rn02_00347929 predicted 2075
9 SASI_Rn02_00347930 predicted 1586
10 SASI_Rn02_00347931 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053287 predicted 1894
2 SASI_Mm01_00053288 predicted 1212
3 SASI_Mm01_00053290 predicted 1355
4 SASI_Mm01_00053291 predicted 2025
5 SASI_Mm02_00337739 predicted 550
6 SASI_Mm01_00053292 predicted 824
7 SASI_Mm01_00053293 predicted 303
8 SASI_Mm01_00053294 predicted 1261
9 SASI_Mm01_00053295 predicted 1798
10 SASI_Mm01_00053296 predicted 1088
11 SASI_Mm01_00053289 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024045
VALIDATED
DDX50 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-364s21c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-960s21c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-789s21c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-229s21c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-229s1c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-789s1c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024045.1-960s1c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-364s1c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024045
VALIDATED
DDX50 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-364s21c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-960s21c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-789s21c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-229s21c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-229s1c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-789s1c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024045.1-960s1c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-364s1c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024045
VALIDATED
DDX50 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-364s21c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-960s21c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-789s21c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024045.1-229s21c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-229s1c1
Sequence:CCGGCGGATGAGAAATCAGAAACAACTCGAGTTGTTTCTGATTTCTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-789s1c1
Sequence:CCGGGCCAAAGACTTCAAAGATATACTCGAGTATATCTTTGAAGTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024045.1-960s1c1
Sequence:CCGGCGACATGTTGTGCTTGATGAACTCGAGTTCATCAAGCACAACATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024045.1-364s1c1
Sequence:CCGGCCAAATCTCATAAGTCAAGAACTCGAGTTCTTGACTTATGAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053183
DDX50 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053183.1-2322s1c1
Sequence:CCGGGCTTGCCTATTTCTGTCTAATCTCGAGATTAGACAGAAATAGGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-1811s1c1
Sequence:CCGGCGATCTTTGATAACTTCTGATCTCGAGATCAGAAGTTATCAAAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-411s1c1
Sequence:CCGGAGCGAGTGTCATCCTCAGAAACTCGAGTTTCTGAGGATGACACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-2051s1c1
Sequence:CCGGCCAGCCAAATTACCTGAAATTCTCGAGAATTTCAGGTAATTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-491s1c1
Sequence:CCGGGCCTTCTCTAATTTCTCCATTCTCGAGAATGGAGAAATTAGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053183
DDX50 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053183.1-2322s1c1
Sequence:CCGGGCTTGCCTATTTCTGTCTAATCTCGAGATTAGACAGAAATAGGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-1811s1c1
Sequence:CCGGCGATCTTTGATAACTTCTGATCTCGAGATCAGAAGTTATCAAAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-411s1c1
Sequence:CCGGAGCGAGTGTCATCCTCAGAAACTCGAGTTTCTGAGGATGACACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-2051s1c1
Sequence:CCGGCCAGCCAAATTACCTGAAATTCTCGAGAATTTCAGGTAATTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-491s1c1
Sequence:CCGGGCCTTCTCTAATTTCTCCATTCTCGAGAATGGAGAAATTAGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053183
DDX50 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053183.1-2322s1c1
Sequence:CCGGGCTTGCCTATTTCTGTCTAATCTCGAGATTAGACAGAAATAGGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-1811s1c1
Sequence:CCGGCGATCTTTGATAACTTCTGATCTCGAGATCAGAAGTTATCAAAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-411s1c1
Sequence:CCGGAGCGAGTGTCATCCTCAGAAACTCGAGTTTCTGAGGATGACACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-2051s1c1
Sequence:CCGGCCAGCCAAATTACCTGAAATTCTCGAGAATTTCAGGTAATTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053183.1-491s1c1
Sequence:CCGGGCCTTCTCTAATTTCTCCATTCTCGAGAATGGAGAAATTAGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)