EMAIL THIS PAGE TO A FRIEND

DDX51

DEAD (Asp-Glu-Ala-Asp) box polypeptide 51

51 Gene Product Result for
UniProtKB ID: Q8N8A6, A8MPT9, Q5CZ71, Q8IXK5, Q96ED1
Gene ID:
Mouse(69663) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Rat(304570) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Zebrafish(445387) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
cow(507418) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Horse(100062070) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
domestic cat(101097921) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
dog(486226) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
chicken(416936) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
naked mole-rat(101717621) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
domestic guinea pig(100717501) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
sheep(101112597) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Domestic Rabbit(100351803) DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175066 Rosetta Predictions human pricing
NM_001107150 Rosetta Predictions rat pricing
NM_027156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368971 predicted 1818
2 SASI_Hs02_00368972 predicted 591
3 SASI_Hs01_00094624 predicted 612
4 SASI_Hs01_00094625 predicted 1620
5 SASI_Hs01_00094627 predicted 964
6 SASI_Hs01_00094630 predicted 2107
7 SASI_Hs01_00094632 predicted 1670
8 SASI_Hs01_00094633 predicted 1915
9 SASI_Hs02_00368973 predicted 2097
10 SASI_Hs02_00368974 predicted 1851
11 SASI_Hs01_00094626 predicted 759
12 SASI_Hs01_00094628 predicted 1435
13 SASI_Hs01_00094629 predicted 2091
14 SASI_Hs01_00094631 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225995 predicted 1301
2 SASI_Rn02_00225996 predicted 1671
3 SASI_Rn02_00225997 predicted 566
4 SASI_Rn02_00225998 predicted 1406
5 SASI_Rn02_00225999 predicted 1753
6 SASI_Rn02_00226000 predicted 636
7 SASI_Rn02_00226001 predicted 1528
8 SASI_Rn02_00226002 predicted 559
9 SASI_Rn02_00226003 predicted 830
10 SASI_Rn02_00226004 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076481 predicted 1593
2 SASI_Mm01_00076482 predicted 1406
3 SASI_Mm01_00076483 predicted 565
4 SASI_Mm01_00076484 predicted 1768
5 SASI_Mm01_00076485 predicted 1948
6 SASI_Mm01_00076486 predicted 501
7 SASI_Mm01_00076487 predicted 1599
8 SASI_Mm01_00076488 predicted 1294
9 SASI_Mm01_00076489 predicted 1750
10 SASI_Mm02_00331671 predicted 1897
11 SASI_Mm01_00076490 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175066
VALIDATED
DDX51 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-1135s1c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-564s1c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-2248s1c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-597s1c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-1539s1c1
Sequence:CCGGCTTCACTAACTCCCGAGAGAACTCGAGTTCTCTCGGGAGTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175066.2-1135s1c2
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-591s21c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-624s21c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-2275s21c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-1162s21c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175066.3-686s21c1
Sequence:CCGGACGGCATCTCGTCCTACTTTCCTCGAGGAAAGTAGGACGAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175066
VALIDATED
DDX51 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-1135s1c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-564s1c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-2248s1c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-597s1c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-1539s1c1
Sequence:CCGGCTTCACTAACTCCCGAGAGAACTCGAGTTCTCTCGGGAGTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175066.2-1135s1c2
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-591s21c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-624s21c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-2275s21c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-1162s21c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175066.3-686s21c1
Sequence:CCGGACGGCATCTCGTCCTACTTTCCTCGAGGAAAGTAGGACGAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175066
VALIDATED
DDX51 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-1135s1c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-564s1c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-2248s1c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_175066.2-597s1c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_175066.2-1539s1c1
Sequence:CCGGCTTCACTAACTCCCGAGAGAACTCGAGTTCTCTCGGGAGTTAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175066.2-1135s1c2
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-591s21c1
Sequence:CCGGGCCTAACTGTGTCAGAAGGAACTCGAGTTCCTTCTGACACAGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-624s21c1
Sequence:CCGGCCTGGTTCCTATCGAGGACATCTCGAGATGTCCTCGATAGGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-2275s21c1
Sequence:CCGGCGGGCAATGAAGCCTTAGTAACTCGAGTTACTAAGGCTTCATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_175066.3-1162s21c1
Sequence:CCGGCGGATGATTGACAGCATGCATCTCGAGATGCATGCTGTCAATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175066.3-686s21c1
Sequence:CCGGACGGCATCTCGTCCTACTTTCCTCGAGGAAAGTAGGACGAGATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027156
DDX51 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027156.2-3680s1c1
Sequence:CCGGCCGGTGTCATTCTGATTCTTTCTCGAGAAAGAATCAGAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1878s1c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1679s1c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1295s1c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-812s1c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-812s21c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1878s21c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1295s21c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1679s21c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027156
DDX51 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027156.2-3680s1c1
Sequence:CCGGCCGGTGTCATTCTGATTCTTTCTCGAGAAAGAATCAGAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1878s1c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1679s1c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1295s1c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-812s1c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-812s21c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1878s21c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1295s21c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1679s21c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027156
DDX51 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027156.2-3680s1c1
Sequence:CCGGCCGGTGTCATTCTGATTCTTTCTCGAGAAAGAATCAGAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1878s1c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1679s1c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-1295s1c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027156.2-812s1c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-812s21c1
Sequence:CCGGCCAACAGGTGAGCAAAGTATTCTCGAGAATACTTTGCTCACCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1878s21c1
Sequence:CCGGGCCTTGTCTCAGTTGGAGAAACTCGAGTTTCTCCAACTGAGACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1295s21c1
Sequence:CCGGGCTGGGACAACAAAGTCCTAACTCGAGTTAGGACTTTGTTGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027156.2-1679s21c1
Sequence:CCGGCCCACAATATCTGAGGACCTACTCGAGTAGGTCCTCAGATATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks