EMAIL THIS PAGE TO A FRIEND

DDX52

DEAD (Asp-Glu-Ala-Asp) box polypeptide 52

123 Gene Product Result for
Synonyms: HUSSY19 ROK1
UniProtKB ID: Q9Y2R4, Q86YG1, Q8N213, Q9NVE0, Q9Y482
Gene ID:
Mouse(78394) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Rat(85432) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
sheep(101112403) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Domestic Rabbit(100349025) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
domestic guinea pig(100734630) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
naked mole-rat(101710449) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Zebrafish(407696) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
domestic cat(101082277) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Horse(100057718) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
cow(510826) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
dog(610374) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
chicken(417660) DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007010 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007010 Rosetta Predictions human pricing
NM_152300 Rosetta Predictions human pricing
NM_053525 Rosetta Predictions rat pricing
NM_030096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025069 predicted 734
2 SASI_Hs01_00025071 predicted 985
3 SASI_Hs01_00025072 predicted 1451
4 SASI_Hs01_00025073 predicted 855
5 SASI_Hs01_00025076 predicted 1501
6 SASI_Hs01_00025077 predicted 1591
7 SASI_Hs02_00342766 predicted 906
8 SASI_Hs01_00025078 predicted 891
9 SASI_Hs02_00342767 predicted 559
10 SASI_Hs02_00342768 predicted 1299
11 SASI_Hs01_00025070 predicted 714
12 SASI_Hs01_00025074 predicted 1720
13 SASI_Hs01_00025075 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237449 predicted 851
2 SASI_Hs01_00237451 predicted 1106
3 SASI_Hs01_00237452 predicted 1558
4 SASI_Hs01_00237453 predicted 974
5 SASI_Hs01_00237456 predicted 1620
6 SASI_Hs01_00237457 predicted 1700
7 SASI_Hs02_00365868 predicted 1027
8 SASI_Hs01_00237458 predicted 1006
9 SASI_Hs02_00365869 predicted 673
10 SASI_Hs02_00365870 predicted 1406
11 SASI_Hs01_00237450 predicted 837
12 SASI_Hs01_00237454 predicted 1835
13 SASI_Hs01_00237455 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082966 predicted 830
2 SASI_Rn01_00082967 predicted 1044
3 SASI_Rn02_00266138 predicted 1550
4 SASI_Rn02_00266139 predicted 788
5 SASI_Rn01_00082968 predicted 708
6 SASI_Rn02_00266140 predicted 846
7 SASI_Rn01_00082970 predicted 1616
8 SASI_Rn01_00082971 predicted 1845
9 SASI_Rn01_00082972 predicted 1148
10 SASI_Rn01_00082973 predicted 240
11 SASI_Rn01_00082969 predicted 826
12 SASI_Rn01_00082974 predicted 1316
13 SASI_Rn01_00082975 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109206 predicted 827
2 SASI_Mm01_00109207 predicted 781
3 SASI_Mm01_00109209 predicted 878
4 SASI_Mm02_00336490 predicted 1848
5 SASI_Mm01_00109210 predicted 843
6 SASI_Mm01_00109212 predicted 415
7 SASI_Mm01_00109213 predicted 1878
8 SASI_Mm01_00109214 predicted 1706
9 SASI_Mm02_00336491 predicted 569
10 SASI_Mm01_00109215 predicted 1299
11 SASI_Mm01_00109208 predicted 708
12 SASI_Mm01_00109211 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030096
VALIDATED
DDX52 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1296s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1862s21c1
Sequence:CCGGGAGTACTTACAACCATCTTTACTCGAGTAAAGATGGTTGTAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-680s21c1
Sequence:CCGGAGCTGAAACAACCGACAAATACTCGAGTATTTGTCGGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-705s21c1
Sequence:CCGGCTTTAGAGCCCTGGTTATATCCTCGAGGATATAACCAGGGCTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030096.1-1100s21c1
Sequence:CCGGTCAACCTGGACAACGTCATTTCTCGAGAAATGACGTTGTCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030096.1-1883s1c1
Sequence:CCGGCCAAACATTTGAAATCCACAACTCGAGTTGTGGATTTCAAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-571s1c1
Sequence:CCGGCCAATTCAGATGCAAGCCATTCTCGAGAATGGCTTGCATCTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030096.1-814s1c1
Sequence:CCGGGCTGCAATAGCAGCTAAGAAACTCGAGTTTCTTAGCTGCTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-743s1c1
Sequence:CCGGCAAGCCAGATTCACAGAGAATCTCGAGATTCTCTGTGAATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-1449s1c1
Sequence:CCGGCCTGGTCATCAATTATGATTTCTCGAGAAATCATAATTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030096
VALIDATED
DDX52 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1296s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1862s21c1
Sequence:CCGGGAGTACTTACAACCATCTTTACTCGAGTAAAGATGGTTGTAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-680s21c1
Sequence:CCGGAGCTGAAACAACCGACAAATACTCGAGTATTTGTCGGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-705s21c1
Sequence:CCGGCTTTAGAGCCCTGGTTATATCCTCGAGGATATAACCAGGGCTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030096.1-1100s21c1
Sequence:CCGGTCAACCTGGACAACGTCATTTCTCGAGAAATGACGTTGTCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030096.1-1883s1c1
Sequence:CCGGCCAAACATTTGAAATCCACAACTCGAGTTGTGGATTTCAAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-571s1c1
Sequence:CCGGCCAATTCAGATGCAAGCCATTCTCGAGAATGGCTTGCATCTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030096.1-814s1c1
Sequence:CCGGGCTGCAATAGCAGCTAAGAAACTCGAGTTTCTTAGCTGCTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-743s1c1
Sequence:CCGGCAAGCCAGATTCACAGAGAATCTCGAGATTCTCTGTGAATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-1449s1c1
Sequence:CCGGCCTGGTCATCAATTATGATTTCTCGAGAAATCATAATTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030096
VALIDATED
DDX52 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1296s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-1862s21c1
Sequence:CCGGGAGTACTTACAACCATCTTTACTCGAGTAAAGATGGTTGTAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-680s21c1
Sequence:CCGGAGCTGAAACAACCGACAAATACTCGAGTATTTGTCGGTTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_030096.1-705s21c1
Sequence:CCGGCTTTAGAGCCCTGGTTATATCCTCGAGGATATAACCAGGGCTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030096.1-1100s21c1
Sequence:CCGGTCAACCTGGACAACGTCATTTCTCGAGAAATGACGTTGTCCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030096.1-1883s1c1
Sequence:CCGGCCAAACATTTGAAATCCACAACTCGAGTTGTGGATTTCAAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-571s1c1
Sequence:CCGGCCAATTCAGATGCAAGCCATTCTCGAGAATGGCTTGCATCTGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030096.1-814s1c1
Sequence:CCGGGCTGCAATAGCAGCTAAGAAACTCGAGTTTCTTAGCTGCTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-743s1c1
Sequence:CCGGCAAGCCAGATTCACAGAGAATCTCGAGATTCTCTGTGAATCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030096.1-1449s1c1
Sequence:CCGGCCTGGTCATCAATTATGATTTCTCGAGAAATCATAATTGATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007010
VALIDATED
DDX52 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-605s21c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1331s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1451s21c1
Sequence:CCGGGCTAGCAAGAGGGATTGATTTCTCGAGAAATCAATCCCTCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-908s21c1
Sequence:CCGGGACTACTCCAAATCGACTAATCTCGAGATTAGTCGATTTGGAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1961s21c1
Sequence:CCGGTACATGGGACTGGTGATAAATCTCGAGATTTATCACCAGTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1403s1c1
Sequence:CCGGCCACAGTTTCAGAGCAGGAAACTCGAGTTTCCTGCTCTGAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1242s1c1
Sequence:CCGGGCCATGAGAGAACTTGTTAAACTCGAGTTTAACAAGTTCTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1716s1c1
Sequence:CCGGCCATTGGAAAGGGAGAGCATTCTCGAGAATGCTCTCCCTTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-605s1c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007010.2-861s1c1
Sequence:CCGGGCCAAGAAATTTGGACCTAAACTCGAGTTTAGGTCCAAATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007010
VALIDATED
DDX52 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-605s21c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1331s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1451s21c1
Sequence:CCGGGCTAGCAAGAGGGATTGATTTCTCGAGAAATCAATCCCTCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-908s21c1
Sequence:CCGGGACTACTCCAAATCGACTAATCTCGAGATTAGTCGATTTGGAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1961s21c1
Sequence:CCGGTACATGGGACTGGTGATAAATCTCGAGATTTATCACCAGTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1403s1c1
Sequence:CCGGCCACAGTTTCAGAGCAGGAAACTCGAGTTTCCTGCTCTGAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1242s1c1
Sequence:CCGGGCCATGAGAGAACTTGTTAAACTCGAGTTTAACAAGTTCTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1716s1c1
Sequence:CCGGCCATTGGAAAGGGAGAGCATTCTCGAGAATGCTCTCCCTTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-605s1c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007010.2-861s1c1
Sequence:CCGGGCCAAGAAATTTGGACCTAAACTCGAGTTTAGGTCCAAATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007010
VALIDATED
DDX52 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-605s21c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1331s21c1
Sequence:CCGGGCTCATATATGAAGGTATTAACTCGAGTTAATACCTTCATATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1451s21c1
Sequence:CCGGGCTAGCAAGAGGGATTGATTTCTCGAGAAATCAATCCCTCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-908s21c1
Sequence:CCGGGACTACTCCAAATCGACTAATCTCGAGATTAGTCGATTTGGAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007010.2-1961s21c1
Sequence:CCGGTACATGGGACTGGTGATAAATCTCGAGATTTATCACCAGTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1403s1c1
Sequence:CCGGCCACAGTTTCAGAGCAGGAAACTCGAGTTTCCTGCTCTGAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1242s1c1
Sequence:CCGGGCCATGAGAGAACTTGTTAAACTCGAGTTTAACAAGTTCTCTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-1716s1c1
Sequence:CCGGCCATTGGAAAGGGAGAGCATTCTCGAGAATGCTCTCCCTTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007010.2-605s1c1
Sequence:CCGGGCCAATCCAAATGCAAGCCATCTCGAGATGGCTTGCATTTGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007010.2-861s1c1
Sequence:CCGGGCCAAGAAATTTGGACCTAAACTCGAGTTTAGGTCCAAATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks