EMAIL THIS PAGE TO A FRIEND

DDX53

DEAD (Asp-Glu-Ala-Asp) box polypeptide 53

23 Gene Product Result for
Synonyms: CAGE CT26
UniProtKB ID: Q86TM3, Q0D2N2, Q6NVV4
Gene ID:
Human(168400) Summary: This intronless gene encodes a protein which contains several domains found in members of the DEAD-box helicase protein family. Other members of this protein family participate in ATP-dependent RNA unwinding. [provided by RefSeq, Sep 2011]
domestic cat(101097457) DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Horse(100059799) DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
naked mole-rat(101703948) DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
domestic guinea pig(100722613) DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
sheep(101107934) DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026021 MISSION® esiRNA esiRNA human DDX53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071223 predicted 1780
2 SASI_Hs01_00071224 predicted 1385
3 SASI_Hs01_00071225 predicted 1523
4 SASI_Hs01_00071227 predicted 1715
5 SASI_Hs01_00071228 predicted 297
6 SASI_Hs01_00071229 predicted 1772
7 SASI_Hs02_00370863 predicted 923
8 SASI_Hs01_00071230 predicted 631
9 SASI_Hs01_00071231 predicted 1592
10 SASI_Hs02_00370864 predicted 504
11 SASI_Hs01_00071226 predicted 1561
12 SASI_Hs01_00071232 predicted 1583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182699
DDX53 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1900s1c1
Sequence:CCGGGCTGAGCAATACAAGTTAAATCTCGAGATTTAACTTGTATTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1805s1c1
Sequence:CCGGCCCTCATCACTCAGAGAGATTCTCGAGAATCTCTCTGAGTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-675s1c1
Sequence:CCGGGCAGGTGATTAACTGGAGAAACTCGAGTTTCTCCAGTTAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-421s1c1
Sequence:CCGGGCGGCTATAGAAACACTTATTCTCGAGAATAAGTGTTTCTATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-861s1c1
Sequence:CCGGGCCAATTATTCTACAAGGAATCTCGAGATTCCTTGTAGAATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1609s21c1
Sequence:CCGGGCGAGCAGTAGAGGACTTTAACTCGAGTTAAAGTCCTCTACTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1647s21c1
Sequence:CCGGTACTGATTACAACTGATATAGCTCGAGCTATATCAGTTGTAATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-914s21c1
Sequence:CCGGTATCTAATGCCTGGGTTTATTCTCGAGAATAAACCCAGGCATTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182699
DDX53 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1900s1c1
Sequence:CCGGGCTGAGCAATACAAGTTAAATCTCGAGATTTAACTTGTATTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1805s1c1
Sequence:CCGGCCCTCATCACTCAGAGAGATTCTCGAGAATCTCTCTGAGTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-675s1c1
Sequence:CCGGGCAGGTGATTAACTGGAGAAACTCGAGTTTCTCCAGTTAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-421s1c1
Sequence:CCGGGCGGCTATAGAAACACTTATTCTCGAGAATAAGTGTTTCTATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-861s1c1
Sequence:CCGGGCCAATTATTCTACAAGGAATCTCGAGATTCCTTGTAGAATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1609s21c1
Sequence:CCGGGCGAGCAGTAGAGGACTTTAACTCGAGTTAAAGTCCTCTACTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1647s21c1
Sequence:CCGGTACTGATTACAACTGATATAGCTCGAGCTATATCAGTTGTAATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-914s21c1
Sequence:CCGGTATCTAATGCCTGGGTTTATTCTCGAGAATAAACCCAGGCATTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182699
DDX53 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 53
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1900s1c1
Sequence:CCGGGCTGAGCAATACAAGTTAAATCTCGAGATTTAACTTGTATTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-1805s1c1
Sequence:CCGGCCCTCATCACTCAGAGAGATTCTCGAGAATCTCTCTGAGTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-675s1c1
Sequence:CCGGGCAGGTGATTAACTGGAGAAACTCGAGTTTCTCCAGTTAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-421s1c1
Sequence:CCGGGCGGCTATAGAAACACTTATTCTCGAGAATAAGTGTTTCTATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182699.1-861s1c1
Sequence:CCGGGCCAATTATTCTACAAGGAATCTCGAGATTCCTTGTAGAATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1609s21c1
Sequence:CCGGGCGAGCAGTAGAGGACTTTAACTCGAGTTAAAGTCCTCTACTGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-1647s21c1
Sequence:CCGGTACTGATTACAACTGATATAGCTCGAGCTATATCAGTTGTAATCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182699.2-914s21c1
Sequence:CCGGTATCTAATGCCTGGGTTTATTCTCGAGAATAAACCCAGGCATTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks