EMAIL THIS PAGE TO A FRIEND

DDX54

DEAD (Asp-Glu-Ala-Asp) box polypeptide 54

75 Gene Product Result for
Synonyms: DP97
UniProtKB ID: Q8TDD1, Q86YT8, Q9BRZ1
Gene ID:
Human(79039) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71990) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Rat(360815) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
sheep(101109648) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
domestic guinea pig(100719268) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
naked mole-rat(101726725) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Zebrafish(286777) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
chicken(416992) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
cow(535152) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
domestic cat(101089146) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
dog(486279) DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111322 Rosetta Predictions human pricing
NM_024072 Rosetta Predictions human pricing
XM_001079855 Rosetta Predictions rat pricing
XM_573400 Rosetta Predictions rat pricing
NM_028041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325384 predicted 1188
2 SASI_Hs02_00325385 predicted 1164
3 SASI_Hs02_00325386 predicted 763
4 SASI_Hs02_00325387 predicted 1070
5 SASI_Hs02_00325388 predicted 331
6 SASI_Hs02_00325389 predicted 1562
7 SASI_Hs02_00325390 predicted 870
8 SASI_Hs02_00325391 predicted 745
9 SASI_Hs02_00325392 predicted 1105
10 SASI_Hs02_00325393 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031499 predicted 1188
2 SASI_Hs02_00356536 predicted 1170
3 SASI_Hs01_00031501 predicted 756
4 SASI_Hs01_00031502 predicted 1079
5 SASI_Hs01_00031503 predicted 331
6 SASI_Hs02_00356537 predicted 1560
7 SASI_Hs01_00031506 predicted 871
8 SASI_Hs02_00356538 predicted 738
9 SASI_Hs01_00031508 predicted 1109
10 SASI_Hs02_00356539 predicted 649
11 SASI_Hs01_00031500 predicted 1160
12 SASI_Hs01_00031504 predicted 2409
13 SASI_Hs01_00031505 predicted 2244
14 SASI_Hs01_00031507 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365738 predicted 2287
2 SASI_Rn02_00365739 predicted 1188
3 SASI_Rn02_00365740 predicted 1197
4 SASI_Rn02_00365741 predicted 485
5 SASI_Rn02_00365742 predicted 1215
6 SASI_Rn02_00365743 predicted 592
7 SASI_Rn02_00365744 predicted 947
8 SASI_Rn02_00365745 predicted 1845
9 SASI_Rn02_00365746 predicted 632
10 SASI_Rn02_00365747 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400226 predicted 2584
2 SASI_Rn02_00400227 predicted 1491
3 SASI_Rn02_00400228 predicted 1505
4 SASI_Rn02_00400229 predicted 787
5 SASI_Rn02_00400230 predicted 1519
6 SASI_Rn02_00400231 predicted 889
7 SASI_Rn02_00400232 predicted 1245
8 SASI_Rn02_00400233 predicted 2140
9 SASI_Rn02_00400234 predicted 937
10 SASI_Rn02_00400235 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333206 predicted 2249
2 SASI_Mm02_00333207 predicted 1142
3 SASI_Mm02_00333208 predicted 1089
4 SASI_Mm02_00333209 predicted 723
5 SASI_Mm02_00333210 predicted 389
6 SASI_Mm02_00333211 predicted 1760
7 SASI_Mm02_00333212 predicted 2263
8 SASI_Mm02_00333213 predicted 1726
9 SASI_Mm02_00333214 predicted 595
10 SASI_Mm02_00333215 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028041
DDX54 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-642s21c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-1161s21c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-543s21c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028041.2-3498s21c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028041.2-3498s1c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-2250s1c1
Sequence:CCGGCCGGTTTATCAGCAGCTCTTACTCGAGTAAGAGCTGCTGATAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-543s1c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-1161s1c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-642s1c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028041
DDX54 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-642s21c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-1161s21c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-543s21c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028041.2-3498s21c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028041.2-3498s1c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-2250s1c1
Sequence:CCGGCCGGTTTATCAGCAGCTCTTACTCGAGTAAGAGCTGCTGATAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-543s1c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-1161s1c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-642s1c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028041
DDX54 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-642s21c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-1161s21c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028041.2-543s21c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028041.2-3498s21c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028041.2-3498s1c1
Sequence:CCGGGTCTACTTAACTGAGTTCATACTCGAGTATGAACTCAGTTAAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-2250s1c1
Sequence:CCGGCCGGTTTATCAGCAGCTCTTACTCGAGTAAGAGCTGCTGATAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-543s1c1
Sequence:CCGGGCAGACCATGAAGTTCACTAACTCGAGTTAGTGAACTTCATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-1161s1c1
Sequence:CCGGCAACAAATGTTCCACCCTCATCTCGAGATGAGGGTGGAACATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028041.2-642s1c1
Sequence:CCGGGCACGAGAACCCTGACATAATCTCGAGATTATGTCAGGGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024072
VALIDATED
DDX54 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-1157s21c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-2296s21c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024072.3-568s21c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-343s21c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-2296s1c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024072.2-568s1c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1246s1c1
Sequence:CCGGGCTGGACAATGTCATCAACTACTCGAGTAGTTGATGACATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-343s1c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1157s1c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024072
VALIDATED
DDX54 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-1157s21c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-2296s21c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024072.3-568s21c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-343s21c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-2296s1c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024072.2-568s1c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1246s1c1
Sequence:CCGGGCTGGACAATGTCATCAACTACTCGAGTAGTTGATGACATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-343s1c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1157s1c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024072
VALIDATED
DDX54 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-1157s21c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-2296s21c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024072.3-568s21c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024072.3-343s21c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-2296s1c1
Sequence:CCGGCCGCTACATCAGCAGCTCCTACTCGAGTAGGAGCTGCTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024072.2-568s1c1
Sequence:CCGGGCAGACCCTGAAGTTCACTAACTCGAGTTAGTGAACTTCAGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1246s1c1
Sequence:CCGGGCTGGACAATGTCATCAACTACTCGAGTAGTTGATGACATTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-343s1c1
Sequence:CCGGCCCGGTGTTCAAAGGCATCATCTCGAGATGATGCCTTTGAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024072.2-1157s1c1
Sequence:CCGGCGCAAGATCAATCTCGCCAAACTCGAGTTTGGCGAGATTGATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks