EMAIL THIS PAGE TO A FRIEND

DDX55

DEAD (Asp-Glu-Ala-Asp) box polypeptide 55

UniProtKB ID: Q8NHQ9, Q658L6, Q9HCH7
Gene ID:
Human(57696) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been confirmed. [provided by RefSeq, Jul 2008]
Mouse(67848) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Rat(100362764) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Zebrafish(286745) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
dog(486246) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
domestic cat(101085752) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
chicken(416820) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
cow(508581) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
naked mole-rat(101698439) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
domestic guinea pig(100734121) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
sheep(101116935) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Domestic Rabbit(100348366) DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020936 Rosetta Predictions human pricing
NM_026409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079320 predicted 911
2 SASI_Hs01_00079321 predicted 1151
3 SASI_Hs01_00079322 predicted 353
4 SASI_Hs01_00079324 predicted 1160
5 SASI_Hs01_00079325 predicted 1048
6 SASI_Hs01_00079326 predicted 1011
7 SASI_Hs01_00079327 predicted 803
8 SASI_Hs01_00079328 predicted 1209
9 SASI_Hs01_00079329 predicted 902
10 SASI_Hs02_00354325 predicted 929
11 SASI_Hs01_00079323 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330204 predicted 878
2 SASI_Mm01_00041325 predicted 576
3 SASI_Mm01_00041326 predicted 1058
4 SASI_Mm01_00041327 predicted 431
5 SASI_Mm01_00041329 predicted 1257
6 SASI_Mm01_00041330 predicted 218
7 SASI_Mm02_00330205 predicted 1242
8 SASI_Mm01_00041331 predicted 592
9 SASI_Mm02_00330206 predicted 1299
10 SASI_Mm01_00041332 predicted 1084
11 SASI_Mm01_00041324 predicted 1803
12 SASI_Mm01_00041328 predicted 568
13 SASI_Mm01_00041333 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026409
DDX55 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026409.1-1710s1c1
Sequence:CCGGCCTTAATGATACAAGGCTCTTCTCGAGAAGAGCCTTGTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1041s1c1
Sequence:CCGGGAATTGATATTCCCGAAGTAACTCGAGTTACTTCGGGAATATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-778s1c1
Sequence:CCGGGAACCACTATATGATCTGTAACTCGAGTTACAGATCATATAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1480s1c1
Sequence:CCGGGACATCGATACCGACACCATTCTCGAGAATGGTGTCGGTATCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1298s1c1
Sequence:CCGGGTGTTCGAGAAGGGCATGAAACTCGAGTTTCATGCCCTTCTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-898s21c1
Sequence:CCGGGTGCGTGTGTGGAATACTATGCTCGAGCATAGTATTCCACACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-830s21c1
Sequence:CCGGATTCAACCAGCTGGTCCATTTCTCGAGAAATGGACCAGCTGGTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1695s21c1
Sequence:CCGGGGTTCTGATATTGACGATGAACTCGAGTTCATCGTCAATATCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1388s21c1
Sequence:CCGCCTTCCGGCTGAAGGATCTTGACTCGAGTCAAGATCCTTCAGCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-974s21c1
Sequence:CCGCGATGAAGTACAAGCGCAATAACTCGAGTTATTGCGCTTGTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-383s21c1
Sequence:CCGGCACGAAGCACTTTCCGCAGTTCTCGAGAACTGCGGAAAGTGCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1346s21c1
Sequence:CCGGGTCCTTTGTGCAGGCTTATGCCTCGAGGCATAAGCCTGCACAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1205s21c1
Sequence:CCGGCATCAACTTCTTGGCCATCAACTCGAGTTGATGGCCAAGAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1116s21c1
Sequence:CCGGAGTGCCTTCGTGCATCGATGTCTCGAGACATCGATGCACGAAGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-347s21c1
Sequence:CCGGGCTGGCCATTCAGATTGATGACTCGAGTCATCAATCTGAATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026409
DDX55 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026409.1-1710s1c1
Sequence:CCGGCCTTAATGATACAAGGCTCTTCTCGAGAAGAGCCTTGTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1041s1c1
Sequence:CCGGGAATTGATATTCCCGAAGTAACTCGAGTTACTTCGGGAATATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-778s1c1
Sequence:CCGGGAACCACTATATGATCTGTAACTCGAGTTACAGATCATATAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1480s1c1
Sequence:CCGGGACATCGATACCGACACCATTCTCGAGAATGGTGTCGGTATCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1298s1c1
Sequence:CCGGGTGTTCGAGAAGGGCATGAAACTCGAGTTTCATGCCCTTCTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-898s21c1
Sequence:CCGGGTGCGTGTGTGGAATACTATGCTCGAGCATAGTATTCCACACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-830s21c1
Sequence:CCGGATTCAACCAGCTGGTCCATTTCTCGAGAAATGGACCAGCTGGTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1695s21c1
Sequence:CCGGGGTTCTGATATTGACGATGAACTCGAGTTCATCGTCAATATCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1388s21c1
Sequence:CCGCCTTCCGGCTGAAGGATCTTGACTCGAGTCAAGATCCTTCAGCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-974s21c1
Sequence:CCGCGATGAAGTACAAGCGCAATAACTCGAGTTATTGCGCTTGTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-383s21c1
Sequence:CCGGCACGAAGCACTTTCCGCAGTTCTCGAGAACTGCGGAAAGTGCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1346s21c1
Sequence:CCGGGTCCTTTGTGCAGGCTTATGCCTCGAGGCATAAGCCTGCACAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1205s21c1
Sequence:CCGGCATCAACTTCTTGGCCATCAACTCGAGTTGATGGCCAAGAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1116s21c1
Sequence:CCGGAGTGCCTTCGTGCATCGATGTCTCGAGACATCGATGCACGAAGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-347s21c1
Sequence:CCGGGCTGGCCATTCAGATTGATGACTCGAGTCATCAATCTGAATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026409
DDX55 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026409.1-1710s1c1
Sequence:CCGGCCTTAATGATACAAGGCTCTTCTCGAGAAGAGCCTTGTATCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1041s1c1
Sequence:CCGGGAATTGATATTCCCGAAGTAACTCGAGTTACTTCGGGAATATCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-778s1c1
Sequence:CCGGGAACCACTATATGATCTGTAACTCGAGTTACAGATCATATAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1480s1c1
Sequence:CCGGGACATCGATACCGACACCATTCTCGAGAATGGTGTCGGTATCGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026409.1-1298s1c1
Sequence:CCGGGTGTTCGAGAAGGGCATGAAACTCGAGTTTCATGCCCTTCTCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-898s21c1
Sequence:CCGGGTGCGTGTGTGGAATACTATGCTCGAGCATAGTATTCCACACACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-830s21c1
Sequence:CCGGATTCAACCAGCTGGTCCATTTCTCGAGAAATGGACCAGCTGGTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1695s21c1
Sequence:CCGGGGTTCTGATATTGACGATGAACTCGAGTTCATCGTCAATATCAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1388s21c1
Sequence:CCGCCTTCCGGCTGAAGGATCTTGACTCGAGTCAAGATCCTTCAGCCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-974s21c1
Sequence:CCGCGATGAAGTACAAGCGCAATAACTCGAGTTATTGCGCTTGTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-383s21c1
Sequence:CCGGCACGAAGCACTTTCCGCAGTTCTCGAGAACTGCGGAAAGTGCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1346s21c1
Sequence:CCGGGTCCTTTGTGCAGGCTTATGCCTCGAGGCATAAGCCTGCACAAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1205s21c1
Sequence:CCGGCATCAACTTCTTGGCCATCAACTCGAGTTGATGGCCAAGAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-1116s21c1
Sequence:CCGGAGTGCCTTCGTGCATCGATGTCTCGAGACATCGATGCACGAAGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026409.3-347s21c1
Sequence:CCGGGCTGGCCATTCAGATTGATGACTCGAGTCATCAATCTGAATGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020936
DDX55 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-144s1c1
Sequence:CCGGCCCTCTGTTCATGCGAAACAACTCGAGTTGTTTCGCATGAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1410s1c1
Sequence:CCGGGATGCCAGAATTGAGAGGAAACTCGAGTTTCCTCTCAATTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1456s1c1
Sequence:CCGGGACGTTAATACCGACACGATTCTCGAGAATCGTGTCGGTATTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-330s1c1
Sequence:CCGGGTCGCATTTCACGAAGCACTTCTCGAGAAGTGCTTCGTGAAATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-811s1c1
Sequence:CCGGCGCAATCATAAGCAGGAGAAACTCGAGTTTCTCCTGCTTATGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020936.1-2232s21c1
Sequence:CCGGTATCATGATGGGTCACATATACTCGAGTATATGTGACCCATCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-895s21c1
Sequence:CCGGGTGAAGGGCGTGAAGATTATGCTCGAGCATAATCTTCACGCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-1325s21c1
Sequence:CCGGAGCATGAATGCAACCTGATTTCTCGAGAAATCAGGTTGCATTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020936
DDX55 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-144s1c1
Sequence:CCGGCCCTCTGTTCATGCGAAACAACTCGAGTTGTTTCGCATGAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1410s1c1
Sequence:CCGGGATGCCAGAATTGAGAGGAAACTCGAGTTTCCTCTCAATTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1456s1c1
Sequence:CCGGGACGTTAATACCGACACGATTCTCGAGAATCGTGTCGGTATTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-330s1c1
Sequence:CCGGGTCGCATTTCACGAAGCACTTCTCGAGAAGTGCTTCGTGAAATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-811s1c1
Sequence:CCGGCGCAATCATAAGCAGGAGAAACTCGAGTTTCTCCTGCTTATGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020936.1-2232s21c1
Sequence:CCGGTATCATGATGGGTCACATATACTCGAGTATATGTGACCCATCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-895s21c1
Sequence:CCGGGTGAAGGGCGTGAAGATTATGCTCGAGCATAATCTTCACGCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-1325s21c1
Sequence:CCGGAGCATGAATGCAACCTGATTTCTCGAGAAATCAGGTTGCATTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020936
DDX55 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-144s1c1
Sequence:CCGGCCCTCTGTTCATGCGAAACAACTCGAGTTGTTTCGCATGAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1410s1c1
Sequence:CCGGGATGCCAGAATTGAGAGGAAACTCGAGTTTCCTCTCAATTCTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-1456s1c1
Sequence:CCGGGACGTTAATACCGACACGATTCTCGAGAATCGTGTCGGTATTAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-330s1c1
Sequence:CCGGGTCGCATTTCACGAAGCACTTCTCGAGAAGTGCTTCGTGAAATGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020936.1-811s1c1
Sequence:CCGGCGCAATCATAAGCAGGAGAAACTCGAGTTTCTCCTGCTTATGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020936.1-2232s21c1
Sequence:CCGGTATCATGATGGGTCACATATACTCGAGTATATGTGACCCATCATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-895s21c1
Sequence:CCGGGTGAAGGGCGTGAAGATTATGCTCGAGCATAATCTTCACGCCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020936.1-1325s21c1
Sequence:CCGGAGCATGAATGCAACCTGATTTCTCGAGAAATCAGGTTGCATTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks