EMAIL THIS PAGE TO A FRIEND

DDX56

DEAD (Asp-Glu-Ala-Asp) box helicase 56

75 Gene Product Result for
Synonyms: DDX21 DDX26 NOH61
UniProtKB ID: Q9NY93, A4D2K9, C9JV95, Q6IAE2, Q9H9I8
Gene ID:
Human(54606) Summary: This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene shows ATPase activity in the presence of polynucleotides and associates with nucleoplasmic 65S preribosomal particles. This gene may be involved in ribosome synthesis, most likely during assembly of the large 60S ribosomal subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(52513) DEAD (Asp-Glu-Ala-Asp) box polypeptide 56
Rat(289780) DEAD (Asp-Glu-Ala-Asp) box helicase 56
sheep(101116224) DEAD (Asp-Glu-Ala-Asp) box helicase 56
domestic guinea pig(100726453) DEAD (Asp-Glu-Ala-Asp) box helicase 56
naked mole-rat(101717253) DEAD (Asp-Glu-Ala-Asp) box helicase 56
Zebrafish(445399) DEAD (Asp-Glu-Ala-Asp) box polypeptide 56
dog(608451) DEAD (Asp-Glu-Ala-Asp) box helicase 56
domestic cat(101099362) DEAD (Asp-Glu-Ala-Asp) box helicase 56
cow(508728) DEAD (Asp-Glu-Ala-Asp) box polypeptide 56
Horse(100065131) DEAD (Asp-Glu-Ala-Asp) box helicase 56
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019082 Rosetta Predictions human pricing
NM_001004211 Rosetta Predictions rat pricing
NM_026538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352680 predicted 985
2 SASI_Hs01_00104738 predicted 1556
3 SASI_Hs02_00352681 predicted 2248
4 SASI_Hs01_00104739 predicted 1423
5 SASI_Hs01_00104740 predicted 1263
6 SASI_Hs01_00104741 predicted 1533
7 SASI_Hs01_00104742 predicted 1970
8 SASI_Hs01_00104743 predicted 1360
9 SASI_Hs01_00104744 predicted 1447
10 SASI_Hs01_00104745 predicted 1256
11 SASI_Hs01_00104746 predicted 2005
12 SASI_Hs01_00104747 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080922 predicted 680
2 SASI_Rn01_00080923 predicted 1152
3 SASI_Rn01_00080924 predicted 781
4 SASI_Rn02_00198193 predicted 1359
5 SASI_Rn01_00080925 predicted 904
6 SASI_Rn01_00080926 predicted 1358
7 SASI_Rn02_00198194 predicted 1014
8 SASI_Rn01_00080927 predicted 628
9 SASI_Rn02_00198195 predicted 689
10 SASI_Rn01_00080929 predicted 1020
11 SASI_Rn01_00080928 predicted 1000
12 SASI_Rn01_00080930 predicted 1579
13 SASI_Rn01_00080931 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101406 predicted 584
2 SASI_Mm01_00101407 predicted 596
3 SASI_Mm01_00101408 predicted 1345
4 SASI_Mm01_00101409 predicted 1273
5 SASI_Mm01_00101410 predicted 727
6 SASI_Mm01_00101411 predicted 531
7 SASI_Mm01_00101412 predicted 922
8 SASI_Mm01_00101413 predicted 1149
9 SASI_Mm01_00101415 predicted 1107
10 SASI_Mm02_00330466 predicted 930
11 SASI_Mm01_00101414 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019082
VALIDATED
DDX56 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1280s21c1
Sequence:CCGGCATAACCCGGTTACCCTTAAGCTCGAGCTTAAGGGTAACCGGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2302s21c1
Sequence:CCGGTCTGGAGCTGAGCACATTGTGCTCGAGCACAATGTGCTCAGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1325s21c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1259s21c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1782s21c1
Sequence:CCGGACAACCCAGGCATAGTCTTAACTCGAGTTAAGACTATGCCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1704s21c1
Sequence:CCGGTGTCTGCTGTGCTCAACTTTGCTCGAGCAAAGTTGAGCACAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2317s21c1
Sequence:CCGGATTGTGGAGCACAGGCTTACACTCGAGTGTAAGCCTGTGCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-322s1c1
Sequence:CCGGCCTTGTTCTTGTTCCTACCAACTCGAGTTGGTAGGAACAAGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1211s1c1
Sequence:CCGGCCAGGCATAGTCTTAACCTTTCTCGAGAAAGGTTAAGACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-749s1c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-683s1c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1659s1c1
Sequence:CCGGGCAGCTTCAAGCACAAAGGAACTCGAGTTCCTTTGTGCTTGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019082
VALIDATED
DDX56 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1280s21c1
Sequence:CCGGCATAACCCGGTTACCCTTAAGCTCGAGCTTAAGGGTAACCGGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2302s21c1
Sequence:CCGGTCTGGAGCTGAGCACATTGTGCTCGAGCACAATGTGCTCAGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1325s21c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1259s21c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1782s21c1
Sequence:CCGGACAACCCAGGCATAGTCTTAACTCGAGTTAAGACTATGCCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1704s21c1
Sequence:CCGGTGTCTGCTGTGCTCAACTTTGCTCGAGCAAAGTTGAGCACAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2317s21c1
Sequence:CCGGATTGTGGAGCACAGGCTTACACTCGAGTGTAAGCCTGTGCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-322s1c1
Sequence:CCGGCCTTGTTCTTGTTCCTACCAACTCGAGTTGGTAGGAACAAGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1211s1c1
Sequence:CCGGCCAGGCATAGTCTTAACCTTTCTCGAGAAAGGTTAAGACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-749s1c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-683s1c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1659s1c1
Sequence:CCGGGCAGCTTCAAGCACAAAGGAACTCGAGTTCCTTTGTGCTTGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019082
VALIDATED
DDX56 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1280s21c1
Sequence:CCGGCATAACCCGGTTACCCTTAAGCTCGAGCTTAAGGGTAACCGGGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2302s21c1
Sequence:CCGGTCTGGAGCTGAGCACATTGTGCTCGAGCACAATGTGCTCAGCTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1325s21c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019082.2-1259s21c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1782s21c1
Sequence:CCGGACAACCCAGGCATAGTCTTAACTCGAGTTAAGACTATGCCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-1704s21c1
Sequence:CCGGTGTCTGCTGTGCTCAACTTTGCTCGAGCAAAGTTGAGCACAGCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_019082.2-2317s21c1
Sequence:CCGGATTGTGGAGCACAGGCTTACACTCGAGTGTAAGCCTGTGCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-322s1c1
Sequence:CCGGCCTTGTTCTTGTTCCTACCAACTCGAGTTGGTAGGAACAAGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1211s1c1
Sequence:CCGGCCAGGCATAGTCTTAACCTTTCTCGAGAAAGGTTAAGACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-749s1c1
Sequence:CCGGCCAGACCAGTTACAGCAGTTTCTCGAGAAACTGCTGTAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019082.1-683s1c1
Sequence:CCGGGCACTCAAGGAGCTGATATTACTCGAGTAATATCAGCTCCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019082.1-1659s1c1
Sequence:CCGGGCAGCTTCAAGCACAAAGGAACTCGAGTTCCTTTGTGCTTGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026538
VALIDATED
DDX56 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-904s21c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-184s21c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1478s21c1
Sequence:CCGGGGCCATGTCCCTGACTATTTGCTCGAGCAAATAGTCAGGGACATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1795s21c1
Sequence:CCGGGGTACTACTGGGCTGCCATTTCTCGAGAAATGGCAGCCCAGTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-562s21c1
Sequence:CCGGCTGTCACTTGCCTCGGATTTACTCGAGTAAATCCGAGGCAAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-904s1c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026538.2-901s1c1
Sequence:CCGGGTGCCACATCATCTCACAGTTCTCGAGAACTGTGAGATGATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-1154s1c1
Sequence:CCGGCCAGGCATAGTTCTGACCTTTCTCGAGAAAGGTCAGAACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-184s1c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026538.2-3137s1c1
Sequence:CCGGGCTCAGCAGGTAAAGGTGTTTCTCGAGAAACACCTTTACCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026538
VALIDATED
DDX56 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-904s21c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-184s21c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1478s21c1
Sequence:CCGGGGCCATGTCCCTGACTATTTGCTCGAGCAAATAGTCAGGGACATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1795s21c1
Sequence:CCGGGGTACTACTGGGCTGCCATTTCTCGAGAAATGGCAGCCCAGTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-562s21c1
Sequence:CCGGCTGTCACTTGCCTCGGATTTACTCGAGTAAATCCGAGGCAAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-904s1c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026538.2-901s1c1
Sequence:CCGGGTGCCACATCATCTCACAGTTCTCGAGAACTGTGAGATGATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-1154s1c1
Sequence:CCGGCCAGGCATAGTTCTGACCTTTCTCGAGAAAGGTCAGAACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-184s1c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026538.2-3137s1c1
Sequence:CCGGGCTCAGCAGGTAAAGGTGTTTCTCGAGAAACACCTTTACCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026538
VALIDATED
DDX56 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 56
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-904s21c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-184s21c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1478s21c1
Sequence:CCGGGGCCATGTCCCTGACTATTTGCTCGAGCAAATAGTCAGGGACATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307547    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-1795s21c1
Sequence:CCGGGGTACTACTGGGCTGCCATTTCTCGAGAAATGGCAGCCCAGTAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026538.3-562s21c1
Sequence:CCGGCTGTCACTTGCCTCGGATTTACTCGAGTAAATCCGAGGCAAGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-904s1c1
Sequence:CCGGCCACATCATCTCACAGTTCAACTCGAGTTGAACTGTGAGATGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026538.2-901s1c1
Sequence:CCGGGTGCCACATCATCTCACAGTTCTCGAGAACTGTGAGATGATGTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-1154s1c1
Sequence:CCGGCCAGGCATAGTTCTGACCTTTCTCGAGAAAGGTCAGAACTATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026538.2-184s1c1
Sequence:CCGGCGCAGCTTATGCTATTCCGATCTCGAGATCGGAATAGCATAAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026538.2-3137s1c1
Sequence:CCGGGCTCAGCAGGTAAAGGTGTTTCTCGAGAAACACCTTTACCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks