EMAIL THIS PAGE TO A FRIEND

DDX58

DEAD (Asp-Glu-Ala-Asp) box polypeptide 58

73 Gene Product Result for
Synonyms: RIG-I RIGI RLR-1
UniProtKB ID: O95786, A2RU81, Q5HYE1, Q5VYT1, Q9NT04
Gene ID:
Human(23586) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
Mouse(230073) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Rat(297989) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
domestic cat(101095926) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
cow(504760) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Horse(100067920) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
dog(100686785) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
naked mole-rat(101717131) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
domestic guinea pig(100718491) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
sheep(101107257) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Domestic Rabbit(100347707) DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014314 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014314 Rosetta Predictions human pricing
NM_001106645 Rosetta Predictions rat pricing
NM_172689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047980 predicted 2375
2 SASI_Hs01_00047981 predicted 2792
3 SASI_Hs02_00345407 predicted 1963
4 SASI_Hs01_00047983 predicted 497
5 SASI_Hs01_00047984 predicted 517
6 SASI_Hs01_00047985 predicted 1095
7 SASI_Hs02_00345408 predicted 1774
8 SASI_Hs01_00047986 predicted 415
9 SASI_Hs01_00047988 predicted 2090
10 SASI_Hs01_00047989 predicted 1045
11 SASI_Hs01_00047982 predicted 2502
12 SASI_Hs01_00047987 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220988 predicted 447
2 SASI_Rn02_00220989 predicted 1655
3 SASI_Rn02_00220990 predicted 1794
4 SASI_Rn02_00220991 predicted 1056
5 SASI_Rn02_00220992 predicted 421
6 SASI_Rn02_00220993 predicted 523
7 SASI_Rn02_00220994 predicted 673
8 SASI_Rn02_00220995 predicted 457
9 SASI_Rn02_00220996 predicted 1227
10 SASI_Rn02_00220997 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145086 predicted 684
2 SASI_Mm01_00145087 predicted 2410
3 SASI_Mm01_00145088 predicted 1799
4 SASI_Mm01_00145089 predicted 1084
5 SASI_Mm02_00344432 predicted 2985
6 SASI_Mm01_00145091 predicted 388
7 SASI_Mm01_00145092 predicted 1066
8 SASI_Mm02_00344433 predicted 2813
9 SASI_Mm01_00145094 predicted 2710
10 SASI_Mm01_00145095 predicted 2143
11 SASI_Mm01_00145090 predicted 2171
12 SASI_Mm01_00145093 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172689
VALIDATED
DDX58 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-2586s1c1
Sequence:CCGGGCAAAGATATTCTGCGCCAAACTCGAGTTTGGCGCAGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172689.2-1822s1c1
Sequence:CCGGGCAATGAGAATCCTAAACTAACTCGAGTTAGTTTAGGATTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-1275s1c1
Sequence:CCGGGCCATGCAACATATCTGTAAACTCGAGTTTACAGATATGTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-352s1c1
Sequence:CCGGCCACAGTTGATCCAAATGATACTCGAGTATCATTTGGATCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1476s21c1
Sequence:CCGGACTGGAACAGGTCGTTTATAACTCGAGTTATAAACGACCTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-157s21c1
Sequence:CCGGCAAGCATTCAGAGACTATATCCTCGAGGATATAGTCTCTGAATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1528s21c1
Sequence:CCGGCGGACTTCGAACACGTTTAAACTCGAGTTTAAACGTGTTCGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172689
VALIDATED
DDX58 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-2586s1c1
Sequence:CCGGGCAAAGATATTCTGCGCCAAACTCGAGTTTGGCGCAGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172689.2-1822s1c1
Sequence:CCGGGCAATGAGAATCCTAAACTAACTCGAGTTAGTTTAGGATTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-1275s1c1
Sequence:CCGGGCCATGCAACATATCTGTAAACTCGAGTTTACAGATATGTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-352s1c1
Sequence:CCGGCCACAGTTGATCCAAATGATACTCGAGTATCATTTGGATCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1476s21c1
Sequence:CCGGACTGGAACAGGTCGTTTATAACTCGAGTTATAAACGACCTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-157s21c1
Sequence:CCGGCAAGCATTCAGAGACTATATCCTCGAGGATATAGTCTCTGAATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1528s21c1
Sequence:CCGGCGGACTTCGAACACGTTTAAACTCGAGTTTAAACGTGTTCGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172689
VALIDATED
DDX58 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-2586s1c1
Sequence:CCGGGCAAAGATATTCTGCGCCAAACTCGAGTTTGGCGCAGAATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172689.2-1822s1c1
Sequence:CCGGGCAATGAGAATCCTAAACTAACTCGAGTTAGTTTAGGATTCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-1275s1c1
Sequence:CCGGGCCATGCAACATATCTGTAAACTCGAGTTTACAGATATGTTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172689.2-352s1c1
Sequence:CCGGCCACAGTTGATCCAAATGATACTCGAGTATCATTTGGATCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1476s21c1
Sequence:CCGGACTGGAACAGGTCGTTTATAACTCGAGTTATAAACGACCTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-157s21c1
Sequence:CCGGCAAGCATTCAGAGACTATATCCTCGAGGATATAGTCTCTGAATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172689.3-1528s21c1
Sequence:CCGGCGGACTTCGAACACGTTTAAACTCGAGTTTAAACGTGTTCGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014314
VALIDATED
DDX58 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-2024s1c1
Sequence:CCGGCCACTTAAACCCAGAGACAATCTCGAGATTGTCTCTGGGTTTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-505s1c1
Sequence:CCGGCCAGAATTATCCCAACCGATACTCGAGTATCGGTTGGGATAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-1907s1c1
Sequence:CCGGGCAAGATCTTACTCAGAGATTCTCGAGAATCTCTGAGTAAGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-2783s1c1
Sequence:CCGGCCATGTGAAGTACAAGACATTCTCGAGAATGTCTTGTACTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014314.2-4152s1c1
Sequence:CCGGCCAGAGAAACTTGCCAGTTATCTCGAGATAACTGGCAAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-511s21c1
Sequence:GTACCGGTTATCCCAACCGATATCATTTCTCGAGAAATGATATCGGTTGGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-4326s21c1
Sequence:CCGGCCCAATACAAATGGATTATTTCTCGAGAAATAATCCATTTGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-2069s21c1
Sequence:CCGGAGCACTTGTGGACGCTTTAAACTCGAGTTTAAAGCGTCCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-1550s21c1
Sequence:CCGGATCACGGATTAGCGACAAATTCTCGAGAATTTGTCGCTAATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-185s21c1
Sequence:CCGGGCAAGCCTTCCAGGATTATATCTCGAGATATAATCCTGGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014314
VALIDATED
DDX58 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-2024s1c1
Sequence:CCGGCCACTTAAACCCAGAGACAATCTCGAGATTGTCTCTGGGTTTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-505s1c1
Sequence:CCGGCCAGAATTATCCCAACCGATACTCGAGTATCGGTTGGGATAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-1907s1c1
Sequence:CCGGGCAAGATCTTACTCAGAGATTCTCGAGAATCTCTGAGTAAGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-2783s1c1
Sequence:CCGGCCATGTGAAGTACAAGACATTCTCGAGAATGTCTTGTACTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014314.2-4152s1c1
Sequence:CCGGCCAGAGAAACTTGCCAGTTATCTCGAGATAACTGGCAAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-511s21c1
Sequence:GTACCGGTTATCCCAACCGATATCATTTCTCGAGAAATGATATCGGTTGGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-4326s21c1
Sequence:CCGGCCCAATACAAATGGATTATTTCTCGAGAAATAATCCATTTGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-2069s21c1
Sequence:CCGGAGCACTTGTGGACGCTTTAAACTCGAGTTTAAAGCGTCCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-1550s21c1
Sequence:CCGGATCACGGATTAGCGACAAATTCTCGAGAATTTGTCGCTAATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-185s21c1
Sequence:CCGGGCAAGCCTTCCAGGATTATATCTCGAGATATAATCCTGGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014314
VALIDATED
DDX58 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-2024s1c1
Sequence:CCGGCCACTTAAACCCAGAGACAATCTCGAGATTGTCTCTGGGTTTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-505s1c1
Sequence:CCGGCCAGAATTATCCCAACCGATACTCGAGTATCGGTTGGGATAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014314.2-1907s1c1
Sequence:CCGGGCAAGATCTTACTCAGAGATTCTCGAGAATCTCTGAGTAAGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014314.2-2783s1c1
Sequence:CCGGCCATGTGAAGTACAAGACATTCTCGAGAATGTCTTGTACTTCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014314.2-4152s1c1
Sequence:CCGGCCAGAGAAACTTGCCAGTTATCTCGAGATAACTGGCAAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-511s21c1
Sequence:GTACCGGTTATCCCAACCGATATCATTTCTCGAGAAATGATATCGGTTGGGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-4326s21c1
Sequence:CCGGCCCAATACAAATGGATTATTTCTCGAGAAATAATCCATTTGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-2069s21c1
Sequence:CCGGAGCACTTGTGGACGCTTTAAACTCGAGTTTAAAGCGTCCACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-1550s21c1
Sequence:CCGGATCACGGATTAGCGACAAATTCTCGAGAATTTGTCGCTAATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014314.3-185s21c1
Sequence:CCGGGCAAGCCTTCCAGGATTATATCTCGAGATATAATCCTGGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks