EMAIL THIS PAGE TO A FRIEND

DDX59

DEAD (Asp-Glu-Ala-Asp) box polypeptide 59

80 Gene Product Result for
Synonyms: ZNHIT5
UniProtKB ID: Q5T1V6, Q6PJL2, Q8IVW3, Q9H0W3
Gene ID:
Mouse(67997) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Rat(289402) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
sheep(101103411) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
domestic guinea pig(100735573) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
naked mole-rat(101699167) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Zebrafish(562123) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
cow(514901) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Horse(100051772) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
domestic cat(101094978) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
dog(480006) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
chicken(424346) DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031306 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031725 Rosetta Predictions human pricing
NM_031306 Rosetta Predictions human pricing
NM_001005535 Rosetta Predictions rat pricing
NM_026500 Rosetta Predictions mouse pricing
NM_178052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307772 predicted 1471
2 SASI_Hs01_00216573 predicted 1093
3 SASI_Hs01_00216574 predicted 1439
4 SASI_Hs02_00307773 predicted 1722
5 SASI_Hs01_00216576 predicted 875
6 SASI_Hs01_00216578 predicted 573
7 SASI_Hs02_00307774 predicted 1827
8 SASI_Hs01_00216580 predicted 938
9 SASI_Hs01_00216581 predicted 1359
10 SASI_Hs01_00216582 predicted 1105
11 SASI_Hs01_00216575 predicted 1091
12 SASI_Hs01_00216577 predicted 1060
13 SASI_Hs01_00216579 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050850 predicted 1013
2 SASI_Hs01_00050851 predicted 1349
3 SASI_Hs01_00050852 predicted 1013
4 SASI_Hs01_00050853 predicted 798
5 SASI_Hs01_00050854 predicted 978
6 SASI_Hs01_00050855 predicted 486
7 SASI_Hs01_00050856 predicted 213
8 SASI_Hs01_00050857 predicted 857
9 SASI_Hs01_00050858 predicted 1276
10 SASI_Hs01_00050859 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040725 predicted 432
2 SASI_Rn01_00040726 predicted 1727
3 SASI_Rn01_00040727 predicted 868
4 SASI_Rn01_00040728 predicted 1705
5 SASI_Rn01_00040729 predicted 421
6 SASI_Rn01_00040730 predicted 1150
7 SASI_Rn01_00040731 predicted 216
8 SASI_Rn02_00198389 predicted 1732
9 SASI_Rn01_00040732 predicted 680
10 SASI_Rn01_00040733 predicted 1561
11 SASI_Rn01_00040734 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063304 predicted 697
2 SASI_Mm01_00063305 predicted 495
3 SASI_Mm01_00063307 predicted 618
4 SASI_Mm02_00330393 predicted 418
5 SASI_Mm01_00063308 predicted 301
6 SASI_Mm01_00063309 predicted 724
7 SASI_Mm01_00063311 predicted 536
8 SASI_Mm02_00330394 predicted 494
9 SASI_Mm01_00063313 predicted 693
10 SASI_Mm02_00330395 predicted 411
11 SASI_Mm01_00063306 predicted 427
12 SASI_Mm01_00063310 predicted 352
13 SASI_Mm01_00063312 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105231 predicted 646
2 SASI_Mm01_00105232 predicted 451
3 SASI_Mm01_00105234 predicted 573
4 SASI_Mm02_00348509 predicted 372
5 SASI_Mm01_00105235 predicted 248
6 SASI_Mm01_00105236 predicted 673
7 SASI_Mm01_00105238 predicted 492
8 SASI_Mm02_00348510 predicted 451
9 SASI_Mm01_00105240 predicted 639
10 SASI_Mm02_00348511 predicted 364
11 SASI_Mm01_00105233 predicted 378
12 SASI_Mm01_00105237 predicted 308
13 SASI_Mm01_00105239 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031725
VALIDATED
DDX59 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000377527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031725.4-2165s21c1
Sequence:CCGGCATAAATGGAAATGTACATGACTCGAGTCATGTACATTTCCATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2106s21c1
Sequence:CCGGTTCTCTGCCACTTGAATATTTCTCGAGAAATATTCAAGTGGCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2048s21c1
Sequence:CCGGGAGCTAATCTTATGGATATTACTCGAGTAATATCCATAAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031725.4-1876s21c1
Sequence:CCGGGCGATTACTTTCATCAATAATCTCGAGATTATTGATGAAAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031725
VALIDATED
DDX59 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000377527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031725.4-2165s21c1
Sequence:CCGGCATAAATGGAAATGTACATGACTCGAGTCATGTACATTTCCATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2106s21c1
Sequence:CCGGTTCTCTGCCACTTGAATATTTCTCGAGAAATATTCAAGTGGCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2048s21c1
Sequence:CCGGGAGCTAATCTTATGGATATTACTCGAGTAATATCCATAAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031725.4-1876s21c1
Sequence:CCGGGCGATTACTTTCATCAATAATCTCGAGATTATTGATGAAAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031725
VALIDATED
DDX59 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000377527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031725.4-2165s21c1
Sequence:CCGGCATAAATGGAAATGTACATGACTCGAGTCATGTACATTTCCATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2106s21c1
Sequence:CCGGTTCTCTGCCACTTGAATATTTCTCGAGAAATATTCAAGTGGCAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031725.4-2048s21c1
Sequence:CCGGGAGCTAATCTTATGGATATTACTCGAGTAATATCCATAAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031725.4-1876s21c1
Sequence:CCGGGCGATTACTTTCATCAATAATCTCGAGATTATTGATGAAAGTAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178052
VALIDATED
DDX59 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-742s21c1
Sequence:CCGGTGGCTTCCCTGAGACCTTAAACTCGAGTTTAAGGTCTCAGGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-706s21c1
Sequence:CCGGAGACGTTGCCAGGCCCATTATCTCGAGATAATGGGCCTGGCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178052.3-1014s21c1
Sequence:CCGGTGCTTAGCATTTGCGAATTAACTCGAGTTAATTCGCAAATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-656s21c1
Sequence:CCGGGACCAGATTGAAACCCTTAAACTCGAGTTTAAGGGTTTCAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-517s21c1
Sequence:CCGGGAAGCATCTGCTACAAGTTAACTCGAGTTAACTTGTAGCAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178052.2-1047s1c1
Sequence:CCGGGCCGGTGACTTTGCTTTGTTTCTCGAGAAACAAAGCAAAGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-896s1c1
Sequence:CCGGGCCTGTTATTATCCGAGCTTTCTCGAGAAAGCTCGGATAATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-965s1c1
Sequence:CCGGGCGGGATTTACCGAGTTTCATCTCGAGATGAAACTCGGTAAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-451s1c1
Sequence:CCGGGCGGTCGTTATGGAGAGTATACTCGAGTATACTCTCCATAACGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-152s1c1
Sequence:CCGGGAGTTCTAATGATGACCTCAACTCGAGTTGAGGTCATCATTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178052
VALIDATED
DDX59 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-742s21c1
Sequence:CCGGTGGCTTCCCTGAGACCTTAAACTCGAGTTTAAGGTCTCAGGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-706s21c1
Sequence:CCGGAGACGTTGCCAGGCCCATTATCTCGAGATAATGGGCCTGGCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178052.3-1014s21c1
Sequence:CCGGTGCTTAGCATTTGCGAATTAACTCGAGTTAATTCGCAAATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-656s21c1
Sequence:CCGGGACCAGATTGAAACCCTTAAACTCGAGTTTAAGGGTTTCAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-517s21c1
Sequence:CCGGGAAGCATCTGCTACAAGTTAACTCGAGTTAACTTGTAGCAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178052.2-1047s1c1
Sequence:CCGGGCCGGTGACTTTGCTTTGTTTCTCGAGAAACAAAGCAAAGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-896s1c1
Sequence:CCGGGCCTGTTATTATCCGAGCTTTCTCGAGAAAGCTCGGATAATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-965s1c1
Sequence:CCGGGCGGGATTTACCGAGTTTCATCTCGAGATGAAACTCGGTAAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-451s1c1
Sequence:CCGGGCGGTCGTTATGGAGAGTATACTCGAGTATACTCTCCATAACGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-152s1c1
Sequence:CCGGGAGTTCTAATGATGACCTCAACTCGAGTTGAGGTCATCATTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178052
VALIDATED
DDX59 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-742s21c1
Sequence:CCGGTGGCTTCCCTGAGACCTTAAACTCGAGTTTAAGGTCTCAGGGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-706s21c1
Sequence:CCGGAGACGTTGCCAGGCCCATTATCTCGAGATAATGGGCCTGGCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178052.3-1014s21c1
Sequence:CCGGTGCTTAGCATTTGCGAATTAACTCGAGTTAATTCGCAAATGCTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-656s21c1
Sequence:CCGGGACCAGATTGAAACCCTTAAACTCGAGTTTAAGGGTTTCAATCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178052.3-517s21c1
Sequence:CCGGGAAGCATCTGCTACAAGTTAACTCGAGTTAACTTGTAGCAGATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178052.2-1047s1c1
Sequence:CCGGGCCGGTGACTTTGCTTTGTTTCTCGAGAAACAAAGCAAAGTCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-896s1c1
Sequence:CCGGGCCTGTTATTATCCGAGCTTTCTCGAGAAAGCTCGGATAATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-965s1c1
Sequence:CCGGGCGGGATTTACCGAGTTTCATCTCGAGATGAAACTCGGTAAATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178052.2-451s1c1
Sequence:CCGGGCGGTCGTTATGGAGAGTATACTCGAGTATACTCTCCATAACGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178052.2-152s1c1
Sequence:CCGGGAGTTCTAATGATGACCTCAACTCGAGTTGAGGTCATCATTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031306
VALIDATED
DDX59 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-932s21c1
Sequence:CCGGTGTTATCATGCGAGCTTTATTCTCGAGAATAAAGCTCGCATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1142s21c1
Sequence:CCGGTGGGCGACTTCTGGATATAATCTCGAGATTATATCCAGAAGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1393s21c1
Sequence:CCGGGTGCCAATGTACGTCAGATTACTCGAGTAATCTGACGTACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031306.2-2486s21c1
Sequence:CCGGTTCATCAACAAGACCTGATAACTCGAGTTATCAGGTCTTGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-776s21c1
Sequence:CCGGTAGTCTCCCTGAGGTCTTAAACTCGAGTTTAAGACCTCAGGGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-934s1c1
Sequence:CCGGCCTGTTATCATGCGAGCTTTACTCGAGTAAAGCTCGCATGATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1722s1c1
Sequence:CCGGGCCTTCAAGTATGGATGAGTACTCGAGTACTCATCCATACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1096s1c1
Sequence:CCGGCCACAGCTTTATCGTCTGCAACTCGAGTTGCAGACGATAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-945s1c1
Sequence:CCGGGCGAGCTTTATTCGAGAGCAACTCGAGTTGCTCTCGAATAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-838s1c1
Sequence:CCGGCCCATTCAAATGCAGATGATTCTCGAGAATCATCTGCATTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031306
VALIDATED
DDX59 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-932s21c1
Sequence:CCGGTGTTATCATGCGAGCTTTATTCTCGAGAATAAAGCTCGCATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1142s21c1
Sequence:CCGGTGGGCGACTTCTGGATATAATCTCGAGATTATATCCAGAAGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1393s21c1
Sequence:CCGGGTGCCAATGTACGTCAGATTACTCGAGTAATCTGACGTACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031306.2-2486s21c1
Sequence:CCGGTTCATCAACAAGACCTGATAACTCGAGTTATCAGGTCTTGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-776s21c1
Sequence:CCGGTAGTCTCCCTGAGGTCTTAAACTCGAGTTTAAGACCTCAGGGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-934s1c1
Sequence:CCGGCCTGTTATCATGCGAGCTTTACTCGAGTAAAGCTCGCATGATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1722s1c1
Sequence:CCGGGCCTTCAAGTATGGATGAGTACTCGAGTACTCATCCATACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1096s1c1
Sequence:CCGGCCACAGCTTTATCGTCTGCAACTCGAGTTGCAGACGATAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-945s1c1
Sequence:CCGGGCGAGCTTTATTCGAGAGCAACTCGAGTTGCTCTCGAATAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-838s1c1
Sequence:CCGGCCCATTCAAATGCAGATGATTCTCGAGAATCATCTGCATTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031306
VALIDATED
DDX59 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-932s21c1
Sequence:CCGGTGTTATCATGCGAGCTTTATTCTCGAGAATAAAGCTCGCATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1142s21c1
Sequence:CCGGTGGGCGACTTCTGGATATAATCTCGAGATTATATCCAGAAGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-1393s21c1
Sequence:CCGGGTGCCAATGTACGTCAGATTACTCGAGTAATCTGACGTACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031306.2-2486s21c1
Sequence:CCGGTTCATCAACAAGACCTGATAACTCGAGTTATCAGGTCTTGTTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_031306.2-776s21c1
Sequence:CCGGTAGTCTCCCTGAGGTCTTAAACTCGAGTTTAAGACCTCAGGGAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-934s1c1
Sequence:CCGGCCTGTTATCATGCGAGCTTTACTCGAGTAAAGCTCGCATGATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1722s1c1
Sequence:CCGGGCCTTCAAGTATGGATGAGTACTCGAGTACTCATCCATACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031306.1-1096s1c1
Sequence:CCGGCCACAGCTTTATCGTCTGCAACTCGAGTTGCAGACGATAAAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-945s1c1
Sequence:CCGGGCGAGCTTTATTCGAGAGCAACTCGAGTTGCTCTCGAATAAAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_031306.1-838s1c1
Sequence:CCGGCCCATTCAAATGCAGATGATTCTCGAGAATCATCTGCATTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks