EMAIL THIS PAGE TO A FRIEND

DDX5

DEAD (Asp-Glu-Ala-Asp) box helicase 5

Synonyms: G17P1 HLR1 HUMP68 p68
UniProtKB ID: P17844, B5BU21, D3DU32, O75681, Q53Y61
Gene ID:
Human(1655) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. This gene consists of 13 exons, and alternatively spliced transcripts containing several intron sequences have been detected, but no isoforms encoded by these transcripts have been identified. [provided by RefSeq, Jul 2008]
Mouse(13207) DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Rat(287765) DEAD (Asp-Glu-Ala-Asp) box helicase 5
naked mole-rat(101707835) DEAD (Asp-Glu-Ala-Asp) box helicase 5
domestic guinea pig(100718573) DEAD (Asp-Glu-Ala-Asp) box helicase 5
sheep(101106186) DEAD (Asp-Glu-Ala-Asp) box helicase 5
Domestic Rabbit(100351285) DEAD (Asp-Glu-Ala-Asp) box helicase 5
Zebrafish(322206) DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
cow(533700) DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Horse(100064168) DEAD (Asp-Glu-Ala-Asp) box helicase 5
domestic cat(101099414) DEAD (Asp-Glu-Ala-Asp) box helicase 5
dog(480472) DEAD (Asp-Glu-Ala-Asp) box helicase 5
chicken(395629) DEAD (Asp-Glu-Ala-Asp) box helicase 5
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004396 Rosetta Predictions human pricing
NM_001007613 Rosetta Predictions rat pricing
NM_007840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048310 predicted 976
2 SASI_Hs01_00048312 predicted 914
3 SASI_Hs02_00337514 predicted 898
4 SASI_Hs02_00337515 predicted 1094
5 SASI_Hs02_00337516 predicted 473
6 SASI_Hs02_00337517 predicted 502
7 SASI_Hs01_00048316 predicted 801
8 SASI_Hs01_00048318 predicted 1527
9 SASI_Hs01_00048319 predicted 1423
10 SASI_Hs02_00337518 predicted 457
11 SASI_Hs01_00048311 predicted 890
12 SASI_Hs01_00048313 predicted 954
13 SASI_Hs01_00048314 predicted 517
14 SASI_Hs01_00048315 predicted 355
15 SASI_Hs01_00048317 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105433 predicted 226
2 SASI_Rn01_00105434 predicted 951
3 SASI_Rn01_00105436 predicted 977
4 SASI_Rn01_00105437 predicted 1684
5 SASI_Rn01_00105438 predicted 1949
6 SASI_Rn01_00105439 predicted 435
7 SASI_Rn01_00105440 predicted 1035
8 SASI_Rn01_00105441 predicted 1920
9 SASI_Rn01_00105442 predicted 2037
10 SASI_Rn02_00198703 predicted 1622
11 SASI_Rn01_00105435 predicted 1783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096788 predicted 414
2 SASI_Mm01_00096789 predicted 1097
3 SASI_Mm01_00096792 predicted 775
4 SASI_Mm01_00096793 predicted 1115
5 SASI_Mm01_00096794 predicted 980
6 SASI_Mm01_00096795 predicted 494
7 SASI_Mm02_00312587 predicted 1870
8 SASI_Mm01_00096796 predicted 235
9 SASI_Mm01_00096797 predicted 1428
10 SASI_Mm02_00312588 predicted 827
11 SASI_Mm01_00096790 predicted 899
12 SASI_Mm01_00096791 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004396
VALIDATED
DDX5 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004396.x-2264s1c1
Sequence:CCGGTACAATAATGAAGGCAATGCACTCGAGTGCATTGCCTTCATTATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-385s1c1
Sequence:CCGGAGGTGGAAACATACAGAAGAACTCGAGTTCTTCTGTATGTTTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-631s1c1
Sequence:CCGGTCCACATCAATCATCAGCCATCTCGAGATGGCTGATGATTGATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-1344s1c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-1536s1c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1426s21c1
Sequence:CCGGCTAACTCCTCAGAGGATTATACTCGAGTATAATCCTCTGAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-311s21c1
Sequence:CCGGTCTTGATGAGCTGCCTAAATTCTCGAGAATTTAGGCAGCTCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004396.2-2153s21c1
Sequence:CCGGCGCTATTTAAGTTGGATATTTCTCGAGAAATATCCAACTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004396.2-1536s21c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1344s21c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004396
VALIDATED
DDX5 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004396.x-2264s1c1
Sequence:CCGGTACAATAATGAAGGCAATGCACTCGAGTGCATTGCCTTCATTATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-385s1c1
Sequence:CCGGAGGTGGAAACATACAGAAGAACTCGAGTTCTTCTGTATGTTTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-631s1c1
Sequence:CCGGTCCACATCAATCATCAGCCATCTCGAGATGGCTGATGATTGATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-1344s1c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-1536s1c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1426s21c1
Sequence:CCGGCTAACTCCTCAGAGGATTATACTCGAGTATAATCCTCTGAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-311s21c1
Sequence:CCGGTCTTGATGAGCTGCCTAAATTCTCGAGAATTTAGGCAGCTCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004396.2-2153s21c1
Sequence:CCGGCGCTATTTAAGTTGGATATTTCTCGAGAAATATCCAACTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004396.2-1536s21c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1344s21c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004396
VALIDATED
DDX5 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004396.x-2264s1c1
Sequence:CCGGTACAATAATGAAGGCAATGCACTCGAGTGCATTGCCTTCATTATTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-385s1c1
Sequence:CCGGAGGTGGAAACATACAGAAGAACTCGAGTTCTTCTGTATGTTTCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-631s1c1
Sequence:CCGGTCCACATCAATCATCAGCCATCTCGAGATGGCTGATGATTGATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004396.x-1344s1c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004396.x-1536s1c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1426s21c1
Sequence:CCGGCTAACTCCTCAGAGGATTATACTCGAGTATAATCCTCTGAGGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-311s21c1
Sequence:CCGGTCTTGATGAGCTGCCTAAATTCTCGAGAATTTAGGCAGCTCATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004396.2-2153s21c1
Sequence:CCGGCGCTATTTAAGTTGGATATTTCTCGAGAAATATCCAACTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004396.2-1536s21c1
Sequence:CCGGCTTATCTCTGTGCTTCGTGAACTCGAGTTCACGAAGCACAGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004396.2-1344s21c1
Sequence:CCGGGCTCCTATTCTGATTGCTACACTCGAGTGTAGCAATCAGAATAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007840
VALIDATED
DDX5 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1541s1c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007840.1-833s1c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1878s1c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-313s1c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-467s1c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-851s21c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-485s21c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1896s21c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1559s21c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-331s21c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007840
VALIDATED
DDX5 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1541s1c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007840.1-833s1c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1878s1c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-313s1c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-467s1c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-851s21c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-485s21c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1896s21c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1559s21c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-331s21c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007840
VALIDATED
DDX5 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1541s1c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007840.1-833s1c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-1878s1c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-313s1c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007840.1-467s1c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-851s21c1
Sequence:CCGGCCTGGAAGACTGATTGACTTTCTCGAGAAAGTCAATCAGTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-485s21c1
Sequence:CCGGGCGAATGTCATGGATGTGATTCTCGAGAATCACATCCATGACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1896s21c1
Sequence:CCGGGCACTCAGCAATATGGAAGTACTCGAGTACTTCCATATTGCTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-1559s21c1
Sequence:CCGGCGGGAAGCTAATCAAGCAATTCTCGAGAATTGCTTGATTAGCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007840.3-331s21c1
Sequence:CCGGGCCCAAATTTGAGAAGAATTTCTCGAGAAATTCTTCTCAAATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks