EMAIL THIS PAGE TO A FRIEND

DDX60

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

84 Gene Product Result for
UniProtKB ID: Q8IY21, Q6PK35, Q9NVE3
Gene ID:
Mouse(234311) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Rat(100360801) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
sheep(101115261) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Domestic Rabbit(100345657) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
domestic guinea pig(100726935) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
naked mole-rat(101702087) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
chicken(422427) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
dog(475493) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
cow(787280) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Horse(100067608) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
domestic cat(101100884) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209141 MISSION® esiRNA esiRNA targeting mouse Ddx60 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017631 Rosetta Predictions human pricing
NM_001081215 Rosetta Predictions mouse pricing
XM_358375 Rosetta Predictions mouse pricing
XM_888617 Rosetta Predictions mouse pricing
XM_898172 Rosetta Predictions mouse pricing
XM_898199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199016 predicted 2322
2 SASI_Hs01_00199018 predicted 574
3 SASI_Hs02_00350308 predicted 4163
4 SASI_Hs01_00199020 predicted 795
5 SASI_Hs01_00199022 predicted 1548
6 SASI_Hs01_00199023 predicted 5176
7 SASI_Hs01_00199024 predicted 3252
8 SASI_Hs01_00199025 predicted 5143
9 SASI_Hs02_00350309 predicted 645
10 SASI_Hs02_00350310 predicted 4123
11 SASI_Hs01_00199017 predicted 2795
12 SASI_Hs01_00199019 predicted 3862
13 SASI_Hs01_00199021 predicted 4686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296311 predicted 1672
2 SASI_Mm02_00296312 predicted 4112
3 SASI_Mm02_00296313 predicted 4994
4 SASI_Mm02_00296314 predicted 2613
5 SASI_Mm02_00296315 predicted 1275
6 SASI_Mm02_00296316 predicted 2503
7 SASI_Mm02_00296317 predicted 3977
8 SASI_Mm02_00296318 predicted 2843
9 SASI_Mm02_00296319 predicted 5229
10 SASI_Mm02_00296320 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267265 predicted 4511
2 SASI_Mm01_00267266 predicted 4997
3 SASI_Mm01_00267267 predicted 4508
4 SASI_Mm01_00267268 predicted 4546
5 SASI_Mm01_00267269 predicted 5219
6 SASI_Mm01_00267270 predicted 5093
7 SASI_Mm01_00267271 predicted 5028
8 SASI_Mm01_00267272 predicted 4604
9 SASI_Mm01_00267273 predicted 5237
10 SASI_Mm01_00267274 predicted 5251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282383 predicted 4586
2 SASI_Mm01_00282384 predicted 5080
3 SASI_Mm01_00282385 predicted 4572
4 SASI_Mm01_00282386 predicted 4618
5 SASI_Mm01_00282387 predicted 5285
6 SASI_Mm01_00282388 predicted 5166
7 SASI_Mm01_00282389 predicted 5106
8 SASI_Mm01_00282390 predicted 4685
9 SASI_Mm01_00282391 predicted 5315
10 SASI_Mm01_00282392 predicted 5315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264468 predicted 2297
2 SASI_Mm01_00264469 predicted 2389
3 SASI_Mm01_00264470 predicted 2316
4 SASI_Mm01_00264471 predicted 2285
5 SASI_Mm01_00264472 predicted 2278
6 SASI_Mm01_00264473 predicted 2282
7 SASI_Mm01_00264474 predicted 2408
8 SASI_Mm01_00264475 predicted 2330
9 SASI_Mm01_00264476 predicted 2314
10 SASI_Mm01_00264477 predicted 2307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206514 predicted 4622
2 SASI_Mm01_00206515 predicted 5106
3 SASI_Mm01_00206516 predicted 4611
4 SASI_Mm01_00206517 predicted 4660
5 SASI_Mm01_00206518 predicted 5319
6 SASI_Mm01_00206519 predicted 5192
7 SASI_Mm01_00206520 predicted 5133
8 SASI_Mm01_00206521 predicted 4718
9 SASI_Mm01_00206522 predicted 5347
10 SASI_Mm01_00206523 predicted 5350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017631
VALIDATED
DDX60 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017631.5-5723s21c1
Sequence:CCGGATGTTGTATGTGACTGAATAACTCGAGTTATTCAGTCACATACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-3314s21c1
Sequence:CCGGGCACTAACAACAGATCATATTCTCGAGAATATGATCTGTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-1083s21c1
Sequence:CCGGGTGTTACTTCATGCTCATTATCTCGAGATAATGAGCATGAAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-514s1c1
Sequence:CCGGGCGTATTTCAACTTCCCTGAACTCGAGTTCAGGGAAGTTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-5327s1c1
Sequence:CCGGCCTTTGAACAACTGAGTACAACTCGAGTTGTACTCAGTTGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-4847s1c1
Sequence:CCGGCCACTTTCCTACGAATTGTTTCTCGAGAAACAATTCGTAGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-849s1c1
Sequence:CCGGGCAGAACATTAAAGATGCTTACTCGAGTAAGCATCTTTAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-1567s1c1
Sequence:CCGGCCAATCAAAGACAGCTCCAATCTCGAGATTGGAGCTGTCTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017631
VALIDATED
DDX60 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017631.5-5723s21c1
Sequence:CCGGATGTTGTATGTGACTGAATAACTCGAGTTATTCAGTCACATACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-3314s21c1
Sequence:CCGGGCACTAACAACAGATCATATTCTCGAGAATATGATCTGTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-1083s21c1
Sequence:CCGGGTGTTACTTCATGCTCATTATCTCGAGATAATGAGCATGAAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-514s1c1
Sequence:CCGGGCGTATTTCAACTTCCCTGAACTCGAGTTCAGGGAAGTTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-5327s1c1
Sequence:CCGGCCTTTGAACAACTGAGTACAACTCGAGTTGTACTCAGTTGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-4847s1c1
Sequence:CCGGCCACTTTCCTACGAATTGTTTCTCGAGAAACAATTCGTAGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-849s1c1
Sequence:CCGGGCAGAACATTAAAGATGCTTACTCGAGTAAGCATCTTTAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-1567s1c1
Sequence:CCGGCCAATCAAAGACAGCTCCAATCTCGAGATTGGAGCTGTCTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017631
VALIDATED
DDX60 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017631.5-5723s21c1
Sequence:CCGGATGTTGTATGTGACTGAATAACTCGAGTTATTCAGTCACATACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-3314s21c1
Sequence:CCGGGCACTAACAACAGATCATATTCTCGAGAATATGATCTGTTGTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017631.5-1083s21c1
Sequence:CCGGGTGTTACTTCATGCTCATTATCTCGAGATAATGAGCATGAAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-514s1c1
Sequence:CCGGGCGTATTTCAACTTCCCTGAACTCGAGTTCAGGGAAGTTGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-5327s1c1
Sequence:CCGGCCTTTGAACAACTGAGTACAACTCGAGTTGTACTCAGTTGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017631.3-4847s1c1
Sequence:CCGGCCACTTTCCTACGAATTGTTTCTCGAGAAACAATTCGTAGGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-849s1c1
Sequence:CCGGGCAGAACATTAAAGATGCTTACTCGAGTAAGCATCTTTAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017631.3-1567s1c1
Sequence:CCGGCCAATCAAAGACAGCTCCAATCTCGAGATTGGAGCTGTCTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081215
DDX60 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5709s21c1
Sequence:CCGGACCCAATCAAATATTGCATTTCTCGAGAAATGCAATATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-516s21c1
Sequence:CCGGTTAGCAAAGGAGGGCAATTTGCTCGAGCAAATTGCCCTCCTTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-826s21c1
Sequence:CCGGATCTGACATCCTTCGTCTTTACTCGAGTAAAGACGAAGGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-2506s21c1
Sequence:CCGGACTACAATATATGGGTCATTACTCGAGTAATGACCCATATATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5790s21c1
Sequence:CCGGAGTATCCTGAAAGTGTAATATCTCGAGATATTACACTTTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081215
DDX60 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5709s21c1
Sequence:CCGGACCCAATCAAATATTGCATTTCTCGAGAAATGCAATATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-516s21c1
Sequence:CCGGTTAGCAAAGGAGGGCAATTTGCTCGAGCAAATTGCCCTCCTTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-826s21c1
Sequence:CCGGATCTGACATCCTTCGTCTTTACTCGAGTAAAGACGAAGGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-2506s21c1
Sequence:CCGGACTACAATATATGGGTCATTACTCGAGTAATGACCCATATATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5790s21c1
Sequence:CCGGAGTATCCTGAAAGTGTAATATCTCGAGATATTACACTTTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081215
DDX60 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5709s21c1
Sequence:CCGGACCCAATCAAATATTGCATTTCTCGAGAAATGCAATATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-516s21c1
Sequence:CCGGTTAGCAAAGGAGGGCAATTTGCTCGAGCAAATTGCCCTCCTTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-826s21c1
Sequence:CCGGATCTGACATCCTTCGTCTTTACTCGAGTAAAGACGAAGGATGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081215.1-2506s21c1
Sequence:CCGGACTACAATATATGGGTCATTACTCGAGTAATGACCCATATATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081215.1-5790s21c1
Sequence:CCGGAGTATCCTGAAAGTGTAATATCTCGAGATATTACACTTTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks