EMAIL THIS PAGE TO A FRIEND

DDX60L

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like

88 Gene Product Result for
UniProtKB ID: Q5H9U9, Q96ND6
Gene ID:
Horse(100067542) DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012967 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048941 MISSION® esiRNA esiRNA human DDX60L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012967 Rosetta Predictions human pricing
XM_037817 Rosetta Predictions human pricing
XM_930964 Rosetta Predictions human pricing
XM_930969 Rosetta Predictions human pricing
XM_930988 Rosetta Predictions human pricing
XM_930996 Rosetta Predictions human pricing
XM_931005 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306257 predicted 1829
2 SASI_Hs02_00306258 predicted 1557
3 SASI_Hs02_00306259 predicted 2013
4 SASI_Hs02_00306260 predicted 1824
5 SASI_Hs02_00306261 predicted 2383
6 SASI_Hs02_00306262 predicted 1614
7 SASI_Hs02_00306263 predicted 4952
8 SASI_Hs02_00306264 predicted 1031
9 SASI_Hs02_00306265 predicted 1680
10 SASI_Hs02_00306266 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_037817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252171 predicted 1832
2 SASI_Hs01_00252172 predicted 2011
3 SASI_Hs01_00252173 predicted 2388
4 SASI_Hs01_00252174 predicted 1615
5 SASI_Hs01_00252175 predicted 4134
6 SASI_Hs01_00252176 predicted 2608
7 SASI_Hs01_00252177 predicted 1032
8 SASI_Hs01_00252178 predicted 2277
9 SASI_Hs01_00252179 predicted 1013
10 SASI_Hs01_00252180 predicted 1678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280028 predicted 1091
2 SASI_Hs01_00280029 predicted 822
3 SASI_Hs01_00280030 predicted 1280
4 SASI_Hs01_00280031 predicted 1659
5 SASI_Hs01_00280032 predicted 879
6 SASI_Hs01_00280033 predicted 1868
7 SASI_Hs01_00280034 predicted 302
8 SASI_Hs01_00280035 predicted 1542
9 SASI_Hs01_00280036 predicted 273
10 SASI_Hs01_00280037 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255162 predicted 1093
2 SASI_Hs01_00255163 predicted 1275
3 SASI_Hs01_00255164 predicted 1658
4 SASI_Hs01_00255165 predicted 883
5 SASI_Hs01_00255166 predicted 4124
6 SASI_Hs01_00255167 predicted 1867
7 SASI_Hs01_00255168 predicted 295
8 SASI_Hs01_00255169 predicted 1546
9 SASI_Hs01_00255170 predicted 270
10 SASI_Hs01_00255171 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264307 predicted 1827
2 SASI_Hs01_00264308 predicted 1728
3 SASI_Hs01_00264309 predicted 1868
4 SASI_Hs01_00264310 predicted 1637
5 SASI_Hs01_00264311 predicted 1705
6 SASI_Hs01_00264312 predicted 1718
7 SASI_Hs01_00264313 predicted 1583
8 SASI_Hs01_00264314 predicted 1895
9 SASI_Hs01_00264315 predicted 1825
10 SASI_Hs01_00264316 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273285 predicted 417
2 SASI_Hs01_00273286 predicted 364
3 SASI_Hs01_00273287 predicted 360
4 SASI_Hs01_00273288 predicted 367
5 SASI_Hs01_00273289 predicted 325
6 SASI_Hs01_00273290 predicted 361
7 SASI_Hs01_00273291 predicted 326
8 SASI_Hs01_00273292 predicted 410
9 SASI_Hs01_00273293 predicted 435
10 SASI_Hs01_00273294 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286463 predicted 209
2 SASI_Hs01_00286464 predicted 206
3 SASI_Hs01_00286465 predicted 203
4 SASI_Hs01_00286466 predicted 198
5 SASI_Hs01_00286467 predicted 296
6 SASI_Hs01_00286468 predicted 244
7 SASI_Hs01_00286469 predicted 238
8 SASI_Hs01_00286470 predicted 246
9 SASI_Hs01_00286471 predicted 242
10 SASI_Hs01_00286472 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012967
VALIDATED
DDX60L MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000230589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-943s21c1
Sequence:CCGGAGGCGTATCAGACTCTATTTCCTCGAGGAAATAGAGTCTGATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-4478s21c1
Sequence:GTACCGGTGCAGGACTTGCATCATATTTCTCGAGAAATATGATGCAAGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-3892s21c1
Sequence:CCGGTATTACCGCGAGTGCGATTTACTCGAGTAAATCGCACTCGCGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012967.1-6352s21c1
Sequence:CCGGATACCCTGTGAACCCGAATATCTCGAGATATTCGGGTTCACAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012967
VALIDATED
DDX60L MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000230589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-943s21c1
Sequence:CCGGAGGCGTATCAGACTCTATTTCCTCGAGGAAATAGAGTCTGATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-4478s21c1
Sequence:GTACCGGTGCAGGACTTGCATCATATTTCTCGAGAAATATGATGCAAGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-3892s21c1
Sequence:CCGGTATTACCGCGAGTGCGATTTACTCGAGTAAATCGCACTCGCGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012967.1-6352s21c1
Sequence:CCGGATACCCTGTGAACCCGAATATCTCGAGATATTCGGGTTCACAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012967
VALIDATED
DDX60L MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000230589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-943s21c1
Sequence:CCGGAGGCGTATCAGACTCTATTTCCTCGAGGAAATAGAGTCTGATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-4478s21c1
Sequence:GTACCGGTGCAGGACTTGCATCATATTTCTCGAGAAATATGATGCAAGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001012967.1-3892s21c1
Sequence:CCGGTATTACCGCGAGTGCGATTTACTCGAGTAAATCGCACTCGCGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012967.1-6352s21c1
Sequence:CCGGATACCCTGTGAACCCGAATATCTCGAGATATTCGGGTTCACAGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks