EMAIL THIS PAGE TO A FRIEND

DDX6

DEAD (Asp-Glu-Ala-Asp) box helicase 6

113 Gene Product Result for
Synonyms: HLR2 P54 RCK
UniProtKB ID: P26196, Q5D048
Gene ID:
Human(1656) Summary: This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Mouse(13209) DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Rat(500988) DEAD (Asp-Glu-Ala-Asp) box helicase 6
Zebrafish(564633) DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
chicken(419783) DEAD (Asp-Glu-Ala-Asp) box helicase 6
domestic cat(101092208) DEAD (Asp-Glu-Ala-Asp) box helicase 6
cow(513906) DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Horse(100063116) DEAD (Asp-Glu-Ala-Asp) box helicase 6
dog(479414) DEAD (Asp-Glu-Ala-Asp) box helicase 6
naked mole-rat(101721046) DEAD (Asp-Glu-Ala-Asp) box helicase 6
domestic guinea pig(100135517) DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
sheep(101103918) DEAD (Asp-Glu-Ala-Asp) box helicase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004397 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004397 Rosetta Predictions human pricing
NM_001109292 Rosetta Predictions rat pricing
NM_001110826 Rosetta Predictions mouse pricing
NM_007841 Rosetta Predictions mouse pricing
NM_181324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208114 predicted 1799
2 SASI_Hs02_00337519 predicted 1912
3 SASI_Hs01_00208115 predicted 939
4 SASI_Hs01_00208116 predicted 1573
5 SASI_Hs01_00208117 predicted 1207
6 SASI_Hs02_00337520 predicted 442
7 SASI_Hs01_00208119 predicted 611
8 SASI_Hs02_00337521 predicted 1479
9 SASI_Hs01_00208120 predicted 1258
10 SASI_Hs01_00208121 predicted 1448
11 SASI_Hs01_00208113 predicted 1102
12 SASI_Hs01_00208118 predicted 1002
13 SASI_Hs01_00208122 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246984 predicted 379
2 SASI_Rn02_00246985 predicted 1599
3 SASI_Rn02_00246986 predicted 864
4 SASI_Rn02_00246987 predicted 1486
5 SASI_Rn02_00246988 predicted 1176
6 SASI_Rn02_00246989 predicted 1126
7 SASI_Rn02_00246990 predicted 1021
8 SASI_Rn02_00246991 predicted 1500
9 SASI_Rn02_00246992 predicted 1527
10 SASI_Rn02_00246993 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305818 predicted 1601
2 SASI_Mm02_00305819 predicted 1483
3 SASI_Mm02_00305820 predicted 1268
4 SASI_Mm02_00305821 predicted 1291
5 SASI_Mm02_00305822 predicted 895
6 SASI_Mm02_00305823 predicted 869
7 SASI_Mm02_00305824 predicted 1497
8 SASI_Mm02_00305825 predicted 1192
9 SASI_Mm02_00305826 predicted 1139
10 SASI_Mm02_00305827 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312589 predicted 1225
2 SASI_Mm02_00312590 predicted 1229
3 SASI_Mm02_00312591 predicted 906
4 SASI_Mm02_00312592 predicted 1080
5 SASI_Mm01_00134621 predicted 498
6 SASI_Mm02_00312593 predicted 1503
7 SASI_Mm02_00312594 predicted 1072
8 SASI_Mm02_00312595 predicted 1820
9 SASI_Mm02_00312596 predicted 1738
10 SASI_Mm01_00134620 predicted 618
11 SASI_Mm01_00134622 predicted 445
12 SASI_Mm01_00134623 predicted 281
13 SASI_Mm01_00134624 predicted 656
14 SASI_Mm01_00134625 predicted 628
15 SASI_Mm01_00134626 predicted 636
16 SASI_Mm01_00134627 predicted 440
17 SASI_Mm01_00134628 predicted 379
18 SASI_Mm01_00134629 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349687 predicted 1575
2 SASI_Mm02_00349688 predicted 1456
3 SASI_Mm02_00349689 predicted 1241
4 SASI_Mm02_00349690 predicted 1250
5 SASI_Mm02_00349691 predicted 867
6 SASI_Mm02_00349692 predicted 841
7 SASI_Mm02_00349693 predicted 1470
8 SASI_Mm02_00349694 predicted 1159
9 SASI_Mm02_00349695 predicted 1112
10 SASI_Mm01_00201588 predicted 523
11 SASI_Mm01_00201587 predicted 678
12 SASI_Mm01_00201589 predicted 516
13 SASI_Mm01_00201590 predicted 357
14 SASI_Mm01_00201591 predicted 724
15 SASI_Mm01_00201592 predicted 695
16 SASI_Mm01_00201593 predicted 711
17 SASI_Mm01_00201594 predicted 500
18 SASI_Mm01_00201595 predicted 440
19 SASI_Mm01_00201596 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181324
DDX6 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181324.2-1790s1c1
Sequence:CCGGGACAAACTACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTAGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-563s1c1
Sequence:CCGGCCAAAGGATCTAAGAATCAAACTCGAGTTTGATTCTTAGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1321s1c1
Sequence:CCGGTCAGATAAACCAGTCCATCATCTCGAGATGATGGACTGGTTTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1096s1c1
Sequence:CCGGGCAGATAATGGAGGATATTATCTCGAGATAATATCCTCCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1055s1c1
Sequence:CCGGGTGCTAGATGAGGCAGATAAACTCGAGTTTATCTGCCTCATCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181324
DDX6 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181324.2-1790s1c1
Sequence:CCGGGACAAACTACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTAGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-563s1c1
Sequence:CCGGCCAAAGGATCTAAGAATCAAACTCGAGTTTGATTCTTAGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1321s1c1
Sequence:CCGGTCAGATAAACCAGTCCATCATCTCGAGATGATGGACTGGTTTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1096s1c1
Sequence:CCGGGCAGATAATGGAGGATATTATCTCGAGATAATATCCTCCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1055s1c1
Sequence:CCGGGTGCTAGATGAGGCAGATAAACTCGAGTTTATCTGCCTCATCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181324
DDX6 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181324.2-1790s1c1
Sequence:CCGGGACAAACTACAGAAGGCTCTTCTCGAGAAGAGCCTTCTGTAGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-563s1c1
Sequence:CCGGCCAAAGGATCTAAGAATCAAACTCGAGTTTGATTCTTAGATCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1321s1c1
Sequence:CCGGTCAGATAAACCAGTCCATCATCTCGAGATGATGGACTGGTTTATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1096s1c1
Sequence:CCGGGCAGATAATGGAGGATATTATCTCGAGATAATATCCTCCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181324.2-1055s1c1
Sequence:CCGGGTGCTAGATGAGGCAGATAAACTCGAGTTTATCTGCCTCATCTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004397
DDX6 MISSION shRNA Bacterial Glycerol Stock
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004397.3-3370s1c1
Sequence:CCGGCCGCTTTGATACATAAACTTTCTCGAGAAAGTTTATGTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1505s1c1
Sequence:CCGGCTGATCTGTTTACCCGAGGTACTCGAGTACCTCGGGTAAACAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1759s1c1
Sequence:CCGGGAGCCTGTAGAAGATGAGAAACTCGAGTTTCTCATCTTCTACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-847s1c1
Sequence:CCGGCCCACTAGAGAACTTGCTCTACTCGAGTAGAGCAAGTTCTCTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1489s1c1
Sequence:CCGGCGCAATCTTGTTTGCACTGATCTCGAGATCAGTGCAAACAAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1679s21c1
Sequence:CCGGGAGACCTATCTCCATCGTATTCTCGAGAATACGATGGAGATAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1544s21c1
Sequence:CCGGGAACATCGAAATCGTGTATTTCTCGAGAAATACACGATTTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-613s21c1
Sequence:CCGGGAGTATGACCACCACTATTAACTCGAGTTAATAGTGGTGGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004397
DDX6 MISSION shRNA shRNA Plasmid DNA
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004397.3-3370s1c1
Sequence:CCGGCCGCTTTGATACATAAACTTTCTCGAGAAAGTTTATGTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1505s1c1
Sequence:CCGGCTGATCTGTTTACCCGAGGTACTCGAGTACCTCGGGTAAACAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1759s1c1
Sequence:CCGGGAGCCTGTAGAAGATGAGAAACTCGAGTTTCTCATCTTCTACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-847s1c1
Sequence:CCGGCCCACTAGAGAACTTGCTCTACTCGAGTAGAGCAAGTTCTCTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1489s1c1
Sequence:CCGGCGCAATCTTGTTTGCACTGATCTCGAGATCAGTGCAAACAAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1679s21c1
Sequence:CCGGGAGACCTATCTCCATCGTATTCTCGAGAATACGATGGAGATAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1544s21c1
Sequence:CCGGGAACATCGAAATCGTGTATTTCTCGAGAAATACACGATTTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-613s21c1
Sequence:CCGGGAGTATGACCACCACTATTAACTCGAGTTAATAGTGGTGGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004397
DDX6 MISSION shRNA Lentiviral Transduction Particles
DEAD (Asp-Glu-Ala-Asp) box helicase 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004397.3-3370s1c1
Sequence:CCGGCCGCTTTGATACATAAACTTTCTCGAGAAAGTTTATGTATCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1505s1c1
Sequence:CCGGCTGATCTGTTTACCCGAGGTACTCGAGTACCTCGGGTAAACAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1759s1c1
Sequence:CCGGGAGCCTGTAGAAGATGAGAAACTCGAGTTTCTCATCTTCTACAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-847s1c1
Sequence:CCGGCCCACTAGAGAACTTGCTCTACTCGAGTAGAGCAAGTTCTCTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004397.3-1489s1c1
Sequence:CCGGCGCAATCTTGTTTGCACTGATCTCGAGATCAGTGCAAACAAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1679s21c1
Sequence:CCGGGAGACCTATCTCCATCGTATTCTCGAGAATACGATGGAGATAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-1544s21c1
Sequence:CCGGGAACATCGAAATCGTGTATTTCTCGAGAAATACACGATTTCGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004397.4-613s21c1
Sequence:CCGGGAGTATGACCACCACTATTAACTCGAGTTAATAGTGGTGGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks