EMAIL THIS PAGE TO A FRIEND

DEAF1

DEAF1 transcription factor

55 Gene Product Result for
Synonyms: NUDR SPN ZMYND5
Gene ID:
Mouse(54006) deformed epidermal autoregulatory factor 1 (Drosophila)
Rat(83632) DEAF1 transcription factor
fruit fly(40164) Deformed epidermal autoregulatory factor-1
chicken(423017) deformed epidermal autoregulatory factor 1 (Drosophila)
domestic cat(101083547) deformed epidermal autoregulatory factor 1 (Drosophila)
cow(509260) DEAF1 transcription factor
dog(483409) deformed epidermal autoregulatory factor 1 (Drosophila)
naked mole-rat(101708785) DEAF1 transcription factor
domestic guinea pig(100718625) DEAF1 transcription factor
sheep(101103106) deformed epidermal autoregulatory factor 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021008 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021008 Rosetta Predictions human pricing
NM_031801 Rosetta Predictions rat pricing
NM_016874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068185 predicted 2116
2 SASI_Hs01_00068186 predicted 2102
3 SASI_Hs01_00068187 predicted 1748
4 SASI_Hs02_00354478 predicted 2300
5 SASI_Hs01_00068188 predicted 1618
6 SASI_Hs02_00354479 predicted 1616
7 SASI_Hs01_00068189 predicted 1310
8 SASI_Hs02_00354480 predicted 2318
9 SASI_Hs01_00068191 predicted 2291
10 SASI_Hs01_00068194 predicted 1873
11 SASI_Hs01_00068190 predicted 1146
12 SASI_Hs01_00068192 predicted 2253
13 SASI_Hs01_00068193 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056414 predicted 1693
2 SASI_Rn01_00056415 predicted 526
3 SASI_Rn01_00056417 predicted 455
4 SASI_Rn01_00056418 predicted 305
5 SASI_Rn01_00056419 predicted 1892
6 SASI_Rn01_00056420 predicted 778
7 SASI_Rn01_00056421 predicted 773
8 SASI_Rn01_00056422 predicted 1709
9 SASI_Rn01_00056423 predicted 1759
10 SASI_Rn02_00265248 predicted 1712
11 SASI_Rn01_00056416 predicted 1572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135308 predicted 1658
2 SASI_Mm01_00135309 predicted 1481
3 SASI_Mm01_00135310 predicted 1815
4 SASI_Mm01_00135311 predicted 1490
5 SASI_Mm01_00135312 predicted 859
6 SASI_Mm01_00135313 predicted 693
7 SASI_Mm01_00135314 predicted 861
8 SASI_Mm01_00135315 predicted 694
9 SASI_Mm02_00323679 predicted 1073
10 SASI_Mm01_00135317 predicted 1706
11 SASI_Mm01_00135316 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016874
VALIDATED
DEAF1 MISSION shRNA Bacterial Glycerol Stock
DEAF1 transcription factor
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.2-512s21c1
Sequence:CCGGGGCAAACGCAGCATCGATATCCTCGAGGATATCGATGCTGCGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-694s21c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-228s21c1
Sequence:CCGGCGAATCTGGGCACATGGATATCTCGAGATATCCATGTGCCCAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-901s21c1
Sequence:CCGGAGGCTCTTCGTCCCTTATAAACTCGAGTTTATAAGGGACGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.1-1871s21c1
Sequence:CCGGGAACGCTGGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016874.2-1628s21c1
Sequence:CCGGGGCGAGAATGCAGGTTGATACCTCGAGGTATCAACCTGCATTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.2-1950s21c1
Sequence:CCGGCTTGCCGGACAAGTTATTAACCTCGAGGTTAATAACTTGTCCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1815s1c1
Sequence:CCGGCGGACAAGTTATTAACAGATTCTCGAGAATCTGTTAATAACTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1486s1c1
Sequence:CCGGCAGGCGAGAATGCAGGTTGATCTCGAGATCAACCTGCATTCTCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-694s1c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-379s1c1
Sequence:CCGGGCAGCATCGATATCAGGACATCTCGAGATGTCCTGATATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016874.1-973s1c1
Sequence:CCGGCCCAAGAACATCACCCTGCTTCTCGAGAAGCAGGGTGATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016874
VALIDATED
DEAF1 MISSION shRNA shRNA Plasmid DNA
DEAF1 transcription factor
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.2-512s21c1
Sequence:CCGGGGCAAACGCAGCATCGATATCCTCGAGGATATCGATGCTGCGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-694s21c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-228s21c1
Sequence:CCGGCGAATCTGGGCACATGGATATCTCGAGATATCCATGTGCCCAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-901s21c1
Sequence:CCGGAGGCTCTTCGTCCCTTATAAACTCGAGTTTATAAGGGACGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.1-1871s21c1
Sequence:CCGGGAACGCTGGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016874.2-1628s21c1
Sequence:CCGGGGCGAGAATGCAGGTTGATACCTCGAGGTATCAACCTGCATTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.2-1950s21c1
Sequence:CCGGCTTGCCGGACAAGTTATTAACCTCGAGGTTAATAACTTGTCCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1815s1c1
Sequence:CCGGCGGACAAGTTATTAACAGATTCTCGAGAATCTGTTAATAACTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1486s1c1
Sequence:CCGGCAGGCGAGAATGCAGGTTGATCTCGAGATCAACCTGCATTCTCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-694s1c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-379s1c1
Sequence:CCGGGCAGCATCGATATCAGGACATCTCGAGATGTCCTGATATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016874.1-973s1c1
Sequence:CCGGCCCAAGAACATCACCCTGCTTCTCGAGAAGCAGGGTGATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016874
VALIDATED
DEAF1 MISSION shRNA Lentiviral Transduction Particles
DEAF1 transcription factor
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.2-512s21c1
Sequence:CCGGGGCAAACGCAGCATCGATATCCTCGAGGATATCGATGCTGCGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-694s21c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-228s21c1
Sequence:CCGGCGAATCTGGGCACATGGATATCTCGAGATATCCATGTGCCCAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016874.1-901s21c1
Sequence:CCGGAGGCTCTTCGTCCCTTATAAACTCGAGTTTATAAGGGACGAAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.1-1871s21c1
Sequence:CCGGGAACGCTGGCAGCTTTCAGAACTCGAGTTCTGAAAGCTGCCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016874.2-1628s21c1
Sequence:CCGGGGCGAGAATGCAGGTTGATACCTCGAGGTATCAACCTGCATTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016874.2-1950s21c1
Sequence:CCGGCTTGCCGGACAAGTTATTAACCTCGAGGTTAATAACTTGTCCGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1815s1c1
Sequence:CCGGCGGACAAGTTATTAACAGATTCTCGAGAATCTGTTAATAACTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-1486s1c1
Sequence:CCGGCAGGCGAGAATGCAGGTTGATCTCGAGATCAACCTGCATTCTCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-694s1c1
Sequence:CCGGCGGTGTATCAAGCAGGGAGAACTCGAGTTCTCCCTGCTTGATACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016874.1-379s1c1
Sequence:CCGGGCAGCATCGATATCAGGACATCTCGAGATGTCCTGATATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016874.1-973s1c1
Sequence:CCGGCCCAAGAACATCACCCTGCTTCTCGAGAAGCAGGGTGATGTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021008
VALIDATED
DEAF1 MISSION shRNA Bacterial Glycerol Stock
DEAF1 transcription factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021008.2-2523s21c1
Sequence:CCGGCAAGTCATTAACACACTTTAACTCGAGTTAAAGTGTGTTAATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-2190s21c1
Sequence:CCGGGAAGGAGCAGTCCTGCGTTAACTCGAGTTAACGCAGGACTGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-1545s21c1
Sequence:CCGGCTGCGACGACATGACCTTAAGCTCGAGCTTAAGGTCATGTCGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021008.2-1490s21c1
Sequence:CCGGTCATCCAGGATGGGATCTTAACTCGAGTTAAGATCCCATCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1648s1c1
Sequence:CCGGCCCAAGAACATCACATTGCTTCTCGAGAAGCAATGTGATGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021008.2-1135s1c1
Sequence:CCGGCTGATTGTCGTCCACACAGATCTCGAGATCTGTGTGGACGACAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1597s1c1
Sequence:CCGGAGGCGCAAGAAGGAGAATGAACTCGAGTTCATTCTCCTTCTTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2055s1c1
Sequence:CCGGGTACCTAGAAGAGATGGTCAACTCGAGTTGACCATCTCTTCTAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2290s1c1
Sequence:CCGGTGGAAGGATCACCAGCACATACTCGAGTATGTGCTGGTGATCCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021008
VALIDATED
DEAF1 MISSION shRNA shRNA Plasmid DNA
DEAF1 transcription factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021008.2-2523s21c1
Sequence:CCGGCAAGTCATTAACACACTTTAACTCGAGTTAAAGTGTGTTAATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-2190s21c1
Sequence:CCGGGAAGGAGCAGTCCTGCGTTAACTCGAGTTAACGCAGGACTGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-1545s21c1
Sequence:CCGGCTGCGACGACATGACCTTAAGCTCGAGCTTAAGGTCATGTCGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021008.2-1490s21c1
Sequence:CCGGTCATCCAGGATGGGATCTTAACTCGAGTTAAGATCCCATCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1648s1c1
Sequence:CCGGCCCAAGAACATCACATTGCTTCTCGAGAAGCAATGTGATGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021008.2-1135s1c1
Sequence:CCGGCTGATTGTCGTCCACACAGATCTCGAGATCTGTGTGGACGACAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1597s1c1
Sequence:CCGGAGGCGCAAGAAGGAGAATGAACTCGAGTTCATTCTCCTTCTTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2055s1c1
Sequence:CCGGGTACCTAGAAGAGATGGTCAACTCGAGTTGACCATCTCTTCTAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2290s1c1
Sequence:CCGGTGGAAGGATCACCAGCACATACTCGAGTATGTGCTGGTGATCCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021008
VALIDATED
DEAF1 MISSION shRNA Lentiviral Transduction Particles
DEAF1 transcription factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021008.2-2523s21c1
Sequence:CCGGCAAGTCATTAACACACTTTAACTCGAGTTAAAGTGTGTTAATGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-2190s21c1
Sequence:CCGGGAAGGAGCAGTCCTGCGTTAACTCGAGTTAACGCAGGACTGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021008.2-1545s21c1
Sequence:CCGGCTGCGACGACATGACCTTAAGCTCGAGCTTAAGGTCATGTCGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021008.2-1490s21c1
Sequence:CCGGTCATCCAGGATGGGATCTTAACTCGAGTTAAGATCCCATCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1648s1c1
Sequence:CCGGCCCAAGAACATCACATTGCTTCTCGAGAAGCAATGTGATGTTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021008.2-1135s1c1
Sequence:CCGGCTGATTGTCGTCCACACAGATCTCGAGATCTGTGTGGACGACAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-1597s1c1
Sequence:CCGGAGGCGCAAGAAGGAGAATGAACTCGAGTTCATTCTCCTTCTTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2055s1c1
Sequence:CCGGGTACCTAGAAGAGATGGTCAACTCGAGTTGACCATCTCTTCTAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021008.2-2290s1c1
Sequence:CCGGTGGAAGGATCACCAGCACATACTCGAGTATGTGCTGGTGATCCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks