EMAIL THIS PAGE TO A FRIEND

DEC1

deleted in esophageal cancer 1

Synonyms: CTS9
Species: Human DEC1(50514)
UniProtKB ID: Q9P2X7
Gene ID:
Human(50514) Summary: The function of this gene is not known. This gene is located in a region commonly deleted in esophageal squamous cell carcinomas. Gene expression is reduced or absent in these carcinomas and thus this is a candidate tumor suppressor gene for esophageal squamous cell carcinomas. [provided by RefSeq, Jul 2008]
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017418 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170839 predicted 893
2 SASI_Hs01_00170840 predicted 1011
3 SASI_Hs02_00349984 predicted 954
4 SASI_Hs01_00170841 predicted 948
5 SASI_Hs01_00170843 predicted 964
6 SASI_Hs01_00170845 predicted 962
7 SASI_Hs02_00349985 predicted 1024
8 SASI_Hs01_00170846 predicted 957
9 SASI_Hs01_00170847 predicted 1023
10 SASI_Hs01_00170848 predicted 1008
11 SASI_Hs01_00170842 predicted 1018
12 SASI_Hs01_00170844 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017418
DEC1 MISSION shRNA Bacterial Glycerol Stock
deleted in esophageal cancer 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-715s21c1
Sequence:CCGGGAGGGAATTGCAGATTGAATGCTCGAGCATTCAATCTGCAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-900s21c1
Sequence:CCGGCCGTTTAGAATCATCTATTTACTCGAGTAAATAGATGATTCTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-955s21c1
Sequence:CCGGGGCTTGTGCCTACGAAGATTACTCGAGTAATCTTCGTAGGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-590s21c1
Sequence:CCGGCCGTGTTACACATGATGGTTTCTCGAGAAACCATCATGTGTAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017418.1-966s1c1
Sequence:CCGGCCTACGAAGATTACTTAAGAACTCGAGTTCTTAAGTAATCTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-660s1c1
Sequence:CCGGAGTCTGCTACAATGGAGGAAACTCGAGTTTCCTCCATTGTAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-592s1c1
Sequence:CCGGGCCGTGTTACACATGATGGTTCTCGAGAACCATCATGTGTAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-634s1c1
Sequence:CCGGGAGAGGTCTGTAAAGTGGCAACTCGAGTTGCCACTTTACAGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-690s1c1
Sequence:CCGGTGTATCTCTTGCCAGGCCCAACTCGAGTTGGGCCTGGCAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017418
DEC1 MISSION shRNA shRNA Plasmid DNA
deleted in esophageal cancer 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-715s21c1
Sequence:CCGGGAGGGAATTGCAGATTGAATGCTCGAGCATTCAATCTGCAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-900s21c1
Sequence:CCGGCCGTTTAGAATCATCTATTTACTCGAGTAAATAGATGATTCTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-955s21c1
Sequence:CCGGGGCTTGTGCCTACGAAGATTACTCGAGTAATCTTCGTAGGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-590s21c1
Sequence:CCGGCCGTGTTACACATGATGGTTTCTCGAGAAACCATCATGTGTAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017418.1-966s1c1
Sequence:CCGGCCTACGAAGATTACTTAAGAACTCGAGTTCTTAAGTAATCTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-660s1c1
Sequence:CCGGAGTCTGCTACAATGGAGGAAACTCGAGTTTCCTCCATTGTAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-592s1c1
Sequence:CCGGGCCGTGTTACACATGATGGTTCTCGAGAACCATCATGTGTAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-634s1c1
Sequence:CCGGGAGAGGTCTGTAAAGTGGCAACTCGAGTTGCCACTTTACAGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-690s1c1
Sequence:CCGGTGTATCTCTTGCCAGGCCCAACTCGAGTTGGGCCTGGCAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017418
DEC1 MISSION shRNA Lentiviral Transduction Particles
deleted in esophageal cancer 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-715s21c1
Sequence:CCGGGAGGGAATTGCAGATTGAATGCTCGAGCATTCAATCTGCAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-900s21c1
Sequence:CCGGCCGTTTAGAATCATCTATTTACTCGAGTAAATAGATGATTCTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359217    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017418.2-955s21c1
Sequence:CCGGGGCTTGTGCCTACGAAGATTACTCGAGTAATCTTCGTAGGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017418.2-590s21c1
Sequence:CCGGCCGTGTTACACATGATGGTTTCTCGAGAAACCATCATGTGTAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017418.1-966s1c1
Sequence:CCGGCCTACGAAGATTACTTAAGAACTCGAGTTCTTAAGTAATCTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-660s1c1
Sequence:CCGGAGTCTGCTACAATGGAGGAAACTCGAGTTTCCTCCATTGTAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-592s1c1
Sequence:CCGGGCCGTGTTACACATGATGGTTCTCGAGAACCATCATGTGTAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-634s1c1
Sequence:CCGGGAGAGGTCTGTAAAGTGGCAACTCGAGTTGCCACTTTACAGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017418.1-690s1c1
Sequence:CCGGTGTATCTCTTGCCAGGCCCAACTCGAGTTGGGCCTGGCAAGAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks