EMAIL THIS PAGE TO A FRIEND

DECR1

2,4-dienoyl CoA reductase 1, mitochondrial

60 Gene Product Result for
Synonyms: DECR NADPH SDR18C1
UniProtKB ID: Q16698, Q2M304, Q93085
Gene ID:
Human(1666) Summary: This gene encodes an accessory enzyme which participates in the beta-oxidation and metabolism of unsaturated fatty enoyl-CoA esters. [provided by RefSeq, Jul 2008]
Mouse(67460) 2,4-dienoyl CoA reductase 1, mitochondrial
Rat(117543) 2,4-dienoyl CoA reductase 1, mitochondrial
Zebrafish(436717) 2,4-dienoyl CoA reductase 1, mitochondrial
cow(509952) 2,4-dienoyl CoA reductase 1, mitochondrial
domestic cat(101087299) 2,4-dienoyl CoA reductase 1, mitochondrial
dog(477938) 2,4-dienoyl CoA reductase 1, mitochondrial
chicken(420218) 2,4-dienoyl CoA reductase 1, mitochondrial
sheep(101115040) 2,4-dienoyl CoA reductase 1, mitochondrial
domestic guinea pig(100715286) 2,4-dienoyl CoA reductase 1, mitochondrial
naked mole-rat(101721782) 2,4-dienoyl CoA reductase 1, mitochondrial
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001359 Rosetta Predictions human pricing
NM_057197 Rosetta Predictions rat pricing
NM_026172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139184 predicted 820
2 SASI_Hs01_00139185 predicted 248
3 SASI_Hs01_00139186 predicted 913
4 SASI_Hs01_00139187 predicted 459
5 SASI_Hs01_00139188 predicted 948
6 SASI_Hs02_00331696 predicted 344
7 SASI_Hs01_00139190 predicted 551
8 SASI_Hs01_00139191 predicted 848
9 SASI_Hs01_00139193 predicted 284
10 SASI_Hs02_00331697 predicted 628
11 SASI_Hs01_00139189 predicted 441
12 SASI_Hs01_00139192 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062323 predicted 395
2 SASI_Rn01_00062325 predicted 872
3 SASI_Rn01_00062326 predicted 507
4 SASI_Rn01_00062327 predicted 702
5 SASI_Rn02_00267146 predicted 316
6 SASI_Rn01_00062328 predicted 286
7 SASI_Rn01_00062329 predicted 565
8 SASI_Rn01_00062330 predicted 606
9 SASI_Rn01_00062331 predicted 495
10 SASI_Rn01_00062332 predicted 338
11 SASI_Rn01_00062324 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150151 predicted 768
2 SASI_Mm01_00150152 predicted 1113
3 SASI_Mm01_00150153 predicted 1073
4 SASI_Mm01_00150154 predicted 836
5 SASI_Mm01_00150155 predicted 634
6 SASI_Mm01_00150156 predicted 1114
7 SASI_Mm01_00150157 predicted 373
8 SASI_Mm01_00150158 predicted 665
9 SASI_Mm01_00150159 predicted 741
10 SASI_Mm02_00329812 predicted 912
11 SASI_Mm01_00150150 predicted 1245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001359
VALIDATED
DECR1 MISSION shRNA Bacterial Glycerol Stock
2,4-dienoyl CoA reductase 1, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-900s1c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-439s1c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_001359.1-961s1c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-350s1c1
Sequence:CCGGGCCTTGGTAAAGGAATGACAACTCGAGTTGTCATTCCTTTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-290s1c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-961s21c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-290s21c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-900s21c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-439s21c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001359
VALIDATED
DECR1 MISSION shRNA shRNA Plasmid DNA
2,4-dienoyl CoA reductase 1, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-900s1c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-439s1c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_001359.1-961s1c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-350s1c1
Sequence:CCGGGCCTTGGTAAAGGAATGACAACTCGAGTTGTCATTCCTTTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-290s1c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-961s21c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-290s21c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-900s21c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-439s21c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001359
VALIDATED
DECR1 MISSION shRNA Lentiviral Transduction Particles
2,4-dienoyl CoA reductase 1, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-900s1c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-439s1c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_001359.1-961s1c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-350s1c1
Sequence:CCGGGCCTTGGTAAAGGAATGACAACTCGAGTTGTCATTCCTTTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001359.1-290s1c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-961s21c1
Sequence:CCGGGTAGAAGAACTCGCAAATCTTCTCGAGAAGATTTGCGAGTTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-290s21c1
Sequence:CCGGCGATGCTACCACCTAATAGTTCTCGAGAACTATTAGGTGGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-900s21c1
Sequence:CCGGCCCAACTGGAACATTTGAGAACTCGAGTTCTCAAATGTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001359.1-439s21c1
Sequence:CCGGGCAGAACAAATTTCTTCTCAACTCGAGTTGAGAAGAAATTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026172
VALIDATED
DECR1 MISSION shRNA Bacterial Glycerol Stock
2,4-dienoyl CoA reductase 1, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-915s1c1
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-699s1c1
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-770s1c1
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026172.3-2086s1c1
Sequence:CCGGCGCTATATTGAGTCTCAGTATCTCGAGATACTGAGACTCAATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-511s1c1
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-511s21c3
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-770s21c2
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-915s21c2
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-699s21c3
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026172
VALIDATED
DECR1 MISSION shRNA shRNA Plasmid DNA
2,4-dienoyl CoA reductase 1, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-915s1c1
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-699s1c1
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-770s1c1
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026172.3-2086s1c1
Sequence:CCGGCGCTATATTGAGTCTCAGTATCTCGAGATACTGAGACTCAATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-511s1c1
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-511s21c3
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-770s21c2
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-915s21c2
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-699s21c3
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026172
VALIDATED
DECR1 MISSION shRNA Lentiviral Transduction Particles
2,4-dienoyl CoA reductase 1, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-915s1c1
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-699s1c1
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-770s1c1
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026172.3-2086s1c1
Sequence:CCGGCGCTATATTGAGTCTCAGTATCTCGAGATACTGAGACTCAATATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026172.3-511s1c1
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-511s21c3
Sequence:CCGGCGAGATCCTGATATGGTACATCTCGAGATGTACCATATCAGGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-770s21c2
Sequence:CCGGGCTTTGTAATGCCAAGTTCTTCTCGAGAAGAACTTGGCATTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-915s21c2
Sequence:CCGGCCCGACTGGAAGATTTGAGAACTCGAGTTCTCAAATCTTCCAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026172.3-699s21c3
Sequence:CCGGGCAGCTAATTAAAGCACAGAACTCGAGTTCTGTGCTTTAATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks