EMAIL THIS PAGE TO A FRIEND

DECR2

2,4-dienoyl CoA reductase 2, peroxisomal

58 Gene Product Result for
Synonyms: PDCR SDR17C1
UniProtKB ID: Q9NUI1, Q6ZRS7, Q96ET0
Gene ID:
Mouse(26378) 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal
Rat(64461) 2,4-dienoyl CoA reductase 2, peroxisomal
naked mole-rat(101720323) 2,4-dienoyl CoA reductase 2, peroxisomal
domestic guinea pig(100713979) 2,4-dienoyl CoA reductase 2, peroxisomal
sheep(101110109) 2,4-dienoyl CoA reductase 2, peroxisomal
Zebrafish(406623) 2,4-dienoyl CoA reductase 2, peroxisomal
dog(100688128) 2,4-dienoyl CoA reductase 2, peroxisomal
domestic cat(101088540) 2,4-dienoyl CoA reductase 2, peroxisomal
cow(768256) 2,4-dienoyl CoA reductase 2, peroxisomal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020664 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007031 MISSION® esiRNA esiRNA targeting mouse Decr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020664 Rosetta Predictions human pricing
NM_171996 Rosetta Predictions rat pricing
NM_011933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207663 predicted 517
2 SASI_Hs02_00353653 predicted 535
3 SASI_Hs01_00207664 predicted 1081
4 SASI_Hs01_00207665 predicted 1065
5 SASI_Hs01_00207666 predicted 1032
6 SASI_Hs01_00207667 predicted 931
7 SASI_Hs01_00207668 predicted 1309
8 SASI_Hs01_00207669 predicted 217
9 SASI_Hs01_00207670 predicted 944
10 SASI_Hs01_00207671 predicted 907
11 SASI_Hs01_00207672 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104625 predicted 389
2 SASI_Rn01_00104626 predicted 767
3 SASI_Rn01_00104627 predicted 871
4 SASI_Rn01_00104628 predicted 858
5 SASI_Rn01_00104629 predicted 512
6 SASI_Rn01_00104630 predicted 992
7 SASI_Rn01_00104631 predicted 1059
8 SASI_Rn01_00104633 predicted 507
9 SASI_Rn02_00269095 predicted 963
10 SASI_Rn01_00104634 predicted 948
11 SASI_Rn01_00104632 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321767 predicted 404
2 SASI_Mm02_00321768 predicted 794
3 SASI_Mm02_00321769 predicted 784
4 SASI_Mm02_00321770 predicted 503
5 SASI_Mm02_00321771 predicted 538
6 SASI_Mm02_00321772 predicted 549
7 SASI_Mm02_00321773 predicted 202
8 SASI_Mm02_00321774 predicted 887
9 SASI_Mm02_00321775 predicted 902
10 SASI_Mm02_00321776 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011933
VALIDATED
DECR2 MISSION shRNA Bacterial Glycerol Stock
2,4-dienoyl CoA reductase 2, peroxisomal
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-199s21c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-419s21c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-491s21c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-795s21c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-762s21c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-762s1c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-199s1c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011933.1-491s1c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-795s1c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-419s1c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011933
VALIDATED
DECR2 MISSION shRNA shRNA Plasmid DNA
2,4-dienoyl CoA reductase 2, peroxisomal
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-199s21c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-419s21c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-491s21c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-795s21c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-762s21c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-762s1c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-199s1c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011933.1-491s1c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-795s1c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-419s1c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011933
VALIDATED
DECR2 MISSION shRNA Lentiviral Transduction Particles
2,4-dienoyl CoA reductase 2, peroxisomal
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-199s21c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-419s21c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-491s21c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-795s21c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011933.2-762s21c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-762s1c1
Sequence:CCGGCTGAGGGTTTAAGGCGATTAACTCGAGTTAATCGCCTTAAACCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-199s1c1
Sequence:CCGGCCAGGACAAAGTGGCCTTTATCTCGAGATAAAGGCCACTTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011933.1-491s1c1
Sequence:CCGGGCTTTGTCTTTCAATGCCTTTCTCGAGAAAGGCATTGAAAGACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-795s1c1
Sequence:CCGGCCAGTTCGAAATTAAAGCATTCTCGAGAATGCTTTAATTTCGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011933.1-419s1c1
Sequence:CCGGGCGCTGCAAGAATTTGGCAAACTCGAGTTTGCCAAATTCTTGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020664
VALIDATED
DECR2 MISSION shRNA Bacterial Glycerol Stock
2,4-dienoyl CoA reductase 2, peroxisomal
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020664.3-423s21c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-926s21c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-228s21c1
Sequence:CCGGGGTTCCGGATTGCTGAGATTTCTCGAGAAATCTCAGCAATCCGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-1074s21c1
Sequence:CCGGCTCTGAACACTCAGCTATTACCTCGAGGTAATAGCTGAGTGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-926s1c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-423s1c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020664.3-487s1c1
Sequence:CCGGCAACGCCTTCAAGACCGTGATCTCGAGATCACGGTCTTGAAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-550s1c1
Sequence:CCGGCTATGAGAAGTTCTTCCGGGACTCGAGTCCCGGAAGAACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-261s1c1
Sequence:CCGGGCTGCCATACGGTGATTGCCACTCGAGTGGCAATCACCGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020664
VALIDATED
DECR2 MISSION shRNA shRNA Plasmid DNA
2,4-dienoyl CoA reductase 2, peroxisomal
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020664.3-423s21c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-926s21c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-228s21c1
Sequence:CCGGGGTTCCGGATTGCTGAGATTTCTCGAGAAATCTCAGCAATCCGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-1074s21c1
Sequence:CCGGCTCTGAACACTCAGCTATTACCTCGAGGTAATAGCTGAGTGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-926s1c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-423s1c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020664.3-487s1c1
Sequence:CCGGCAACGCCTTCAAGACCGTGATCTCGAGATCACGGTCTTGAAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-550s1c1
Sequence:CCGGCTATGAGAAGTTCTTCCGGGACTCGAGTCCCGGAAGAACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-261s1c1
Sequence:CCGGGCTGCCATACGGTGATTGCCACTCGAGTGGCAATCACCGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020664
VALIDATED
DECR2 MISSION shRNA Lentiviral Transduction Particles
2,4-dienoyl CoA reductase 2, peroxisomal
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020664.3-423s21c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-926s21c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-228s21c1
Sequence:CCGGGGTTCCGGATTGCTGAGATTTCTCGAGAAATCTCAGCAATCCGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020664.3-1074s21c1
Sequence:CCGGCTCTGAACACTCAGCTATTACCTCGAGGTAATAGCTGAGTGTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-926s1c1
Sequence:CCGGACGTTCCCAAACGGTGTCAAACTCGAGTTTGACACCGTTTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-423s1c1
Sequence:CCGGGAATCGACATTCTCATTAACTCTCGAGAGTTAATGAGAATGTCGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020664.3-487s1c1
Sequence:CCGGCAACGCCTTCAAGACCGTGATCTCGAGATCACGGTCTTGAAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-550s1c1
Sequence:CCGGCTATGAGAAGTTCTTCCGGGACTCGAGTCCCGGAAGAACTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020664.3-261s1c1
Sequence:CCGGGCTGCCATACGGTGATTGCCACTCGAGTGGCAATCACCGTATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks