EMAIL THIS PAGE TO A FRIEND

DEDD2

death effector domain containing 2

111 Gene Product Result for
Synonyms: FLAME-3
UniProtKB ID: Q8WXF8, Q8NBR2, Q8NES1, Q8TAA8, Q96D35
Gene ID:
Human(162989) Summary: This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(67379) death effector domain-containing DNA binding protein 2
Rat(687118) death effector domain containing 2
dog(613012) death effector domain containing 2
domestic cat(101083891) death effector domain containing 2
cow(534251) death effector domain containing 2
naked mole-rat(101717772) death effector domain containing 2
domestic guinea pig(100723423) death effector domain containing 2
sheep(101104519) death effector domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_026117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133328 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213841 MISSION® esiRNA esiRNA targeting mouse Dedd2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133328 Rosetta Predictions human pricing
XM_001077155 Rosetta Predictions rat pricing
NM_207677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168512 predicted 1223
2 SASI_Hs01_00168513 predicted 461
3 SASI_Hs01_00168514 predicted 952
4 SASI_Hs01_00168515 predicted 624
5 SASI_Hs02_00362998 predicted 1202
6 SASI_Hs01_00168516 predicted 1464
7 SASI_Hs01_00168517 predicted 633
8 SASI_Hs01_00168518 predicted 1207
9 SASI_Hs01_00168519 predicted 254
10 SASI_Hs02_00362999 predicted 387
11 SASI_Hs01_00168510 predicted 1136
12 SASI_Hs01_00168511 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355980 predicted 499
2 SASI_Rn02_00355981 predicted 1552
3 SASI_Rn02_00355982 predicted 1119
4 SASI_Rn02_00355983 predicted 1339
5 SASI_Rn02_00355984 predicted 1404
6 SASI_Rn02_00355985 predicted 1332
7 SASI_Rn02_00355986 predicted 1001
8 SASI_Rn02_00355987 predicted 1414
9 SASI_Rn02_00355988 predicted 1322
10 SASI_Rn02_00355989 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352206 predicted 1453
2 SASI_Mm02_00352207 predicted 1256
3 SASI_Mm02_00352208 predicted 973
4 SASI_Mm01_00139900 predicted 1570
5 SASI_Mm01_00139904 predicted 895
6 SASI_Mm02_00352209 predicted 192
7 SASI_Mm01_00139905 predicted 512
8 SASI_Mm02_00352210 predicted 1205
9 SASI_Mm02_00352211 predicted 977
10 SASI_Mm02_00352212 predicted 1450
11 SASI_Mm01_00139899 predicted 414
12 SASI_Mm01_00139901 predicted 972
13 SASI_Mm01_00139902 predicted 979
14 SASI_Mm01_00139903 predicted 985
15 SASI_Mm01_00139906 predicted 1043
16 SASI_Mm01_00139907 predicted 1050
17 SASI_Mm01_00139908 predicted 835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207677
VALIDATED
DEDD2 MISSION shRNA Bacterial Glycerol Stock
death effector domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-1273s21c1
Sequence:CCGGTGTGGGCTTTGAGGCATAAACCTCGAGGTTTATGCCTCAAAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-202s21c1
Sequence:CCGGATGCTGTCGCTTCACCGTATGCTCGAGCATACGGTGAAGCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-472s21c1
Sequence:CCGGGAGCGATACAGCTATGGCAATCTCGAGATTGCCATAGCTGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-979s21c1
Sequence:CCGGGTGTTCCTGACTGAGGCTTTACTCGAGTAAAGCCTCAGTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-175s21c1
Sequence:CCGGGAGGATGAGTGTTTGGATTACCTCGAGGTAATCCAAACACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207677
VALIDATED
DEDD2 MISSION shRNA shRNA Plasmid DNA
death effector domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-1273s21c1
Sequence:CCGGTGTGGGCTTTGAGGCATAAACCTCGAGGTTTATGCCTCAAAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-202s21c1
Sequence:CCGGATGCTGTCGCTTCACCGTATGCTCGAGCATACGGTGAAGCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-472s21c1
Sequence:CCGGGAGCGATACAGCTATGGCAATCTCGAGATTGCCATAGCTGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-979s21c1
Sequence:CCGGGTGTTCCTGACTGAGGCTTTACTCGAGTAAAGCCTCAGTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-175s21c1
Sequence:CCGGGAGGATGAGTGTTTGGATTACCTCGAGGTAATCCAAACACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207677
VALIDATED
DEDD2 MISSION shRNA Lentiviral Transduction Particles
death effector domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-1273s21c1
Sequence:CCGGTGTGGGCTTTGAGGCATAAACCTCGAGGTTTATGCCTCAAAGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-202s21c1
Sequence:CCGGATGCTGTCGCTTCACCGTATGCTCGAGCATACGGTGAAGCGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-472s21c1
Sequence:CCGGGAGCGATACAGCTATGGCAATCTCGAGATTGCCATAGCTGTATCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207677.3-979s21c1
Sequence:CCGGGTGTTCCTGACTGAGGCTTTACTCGAGTAAAGCCTCAGTCAGGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207677.3-175s21c1
Sequence:CCGGGAGGATGAGTGTTTGGATTACCTCGAGGTAATCCAAACACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026117
DEDD2 MISSION shRNA Bacterial Glycerol Stock
death effector domain containing 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000173703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026117.2-1587s1c1
Sequence:CCGGCTTGCCCATTCATCTAACCAACTCGAGTTGGTTAGATGAATGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026117.2-148s1c1
Sequence:CCGGGTGTTTGGATTACTACGGCATCTCGAGATGCCGTAGTAATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026117
DEDD2 MISSION shRNA shRNA Plasmid DNA
death effector domain containing 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000173703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026117.2-1587s1c1
Sequence:CCGGCTTGCCCATTCATCTAACCAACTCGAGTTGGTTAGATGAATGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026117.2-148s1c1
Sequence:CCGGGTGTTTGGATTACTACGGCATCTCGAGATGCCGTAGTAATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026117
DEDD2 MISSION shRNA Lentiviral Transduction Particles
death effector domain containing 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000173703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026117.2-1587s1c1
Sequence:CCGGCTTGCCCATTCATCTAACCAACTCGAGTTGGTTAGATGAATGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026117.2-148s1c1
Sequence:CCGGGTGTTTGGATTACTACGGCATCTCGAGATGCCGTAGTAATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133328
VALIDATED
DEDD2 MISSION shRNA Bacterial Glycerol Stock
death effector domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-487s1c1
Sequence:CCGGCAAATTCTCAGCAGGGTCAGTCTCGAGACTGACCCTGCTGAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-428s1c1
Sequence:CCGGCAGCTCTTCAAAGAGGACAGACTCGAGTCTGTCCTCTTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-805s1c1
Sequence:CCGGCCGTGGTTTGTGACATCAAGTCTCGAGACTTGATGTCACAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-403s1c1
Sequence:CCGGCAGAACGCTATAGCTATGGCACTCGAGTGCCATAGCTATAGCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1357s1c1
Sequence:CCGGGCACATTGTATCTCTGATCTTCTCGAGAAGATCAGAGATACAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1680s1c1
Sequence:CCGGGCTGAACATAGACTTGCACTTCTCGAGAAGTGCAAGTCTATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-398s1c1
Sequence:CCGGGTCTCCAGAACGCTATAGCTACTCGAGTAGCTATAGCGTTCTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-470s1c1
Sequence:CCGGGCAGTCAAGCAGTTCTGCAAACTCGAGTTTGCAGAACTGCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133328.2-1473s1c1
Sequence:CCGGGCACACACTTCTTTGGCCTAACTCGAGTTAGGCCAAAGAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-821s1c1
Sequence:CCGGCAAGTTCTCAGAGCTCTCCTACTCGAGTAGGAGAGCTCTGAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133328
VALIDATED
DEDD2 MISSION shRNA shRNA Plasmid DNA
death effector domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-487s1c1
Sequence:CCGGCAAATTCTCAGCAGGGTCAGTCTCGAGACTGACCCTGCTGAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-428s1c1
Sequence:CCGGCAGCTCTTCAAAGAGGACAGACTCGAGTCTGTCCTCTTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-805s1c1
Sequence:CCGGCCGTGGTTTGTGACATCAAGTCTCGAGACTTGATGTCACAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-403s1c1
Sequence:CCGGCAGAACGCTATAGCTATGGCACTCGAGTGCCATAGCTATAGCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1357s1c1
Sequence:CCGGGCACATTGTATCTCTGATCTTCTCGAGAAGATCAGAGATACAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1680s1c1
Sequence:CCGGGCTGAACATAGACTTGCACTTCTCGAGAAGTGCAAGTCTATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-398s1c1
Sequence:CCGGGTCTCCAGAACGCTATAGCTACTCGAGTAGCTATAGCGTTCTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-470s1c1
Sequence:CCGGGCAGTCAAGCAGTTCTGCAAACTCGAGTTTGCAGAACTGCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133328.2-1473s1c1
Sequence:CCGGGCACACACTTCTTTGGCCTAACTCGAGTTAGGCCAAAGAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-821s1c1
Sequence:CCGGCAAGTTCTCAGAGCTCTCCTACTCGAGTAGGAGAGCTCTGAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133328
VALIDATED
DEDD2 MISSION shRNA Lentiviral Transduction Particles
death effector domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-487s1c1
Sequence:CCGGCAAATTCTCAGCAGGGTCAGTCTCGAGACTGACCCTGCTGAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-428s1c1
Sequence:CCGGCAGCTCTTCAAAGAGGACAGACTCGAGTCTGTCCTCTTTGAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-805s1c1
Sequence:CCGGCCGTGGTTTGTGACATCAAGTCTCGAGACTTGATGTCACAAACCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-403s1c1
Sequence:CCGGCAGAACGCTATAGCTATGGCACTCGAGTGCCATAGCTATAGCGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1357s1c1
Sequence:CCGGGCACATTGTATCTCTGATCTTCTCGAGAAGATCAGAGATACAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_133328.2-1680s1c1
Sequence:CCGGGCTGAACATAGACTTGCACTTCTCGAGAAGTGCAAGTCTATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-398s1c1
Sequence:CCGGGTCTCCAGAACGCTATAGCTACTCGAGTAGCTATAGCGTTCTGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-470s1c1
Sequence:CCGGGCAGTCAAGCAGTTCTGCAAACTCGAGTTTGCAGAACTGCTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133328.2-1473s1c1
Sequence:CCGGGCACACACTTCTTTGGCCTAACTCGAGTTAGGCCAAAGAAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133328.2-821s1c1
Sequence:CCGGCAAGTTCTCAGAGCTCTCCTACTCGAGTAGGAGAGCTCTGAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks