EMAIL THIS PAGE TO A FRIEND

DEDD

death effector domain containing

Synonyms: CASP8IP1 DEDD1 DEFT FLDED1
UniProtKB ID: O75618, D3DVF5, O60737
Gene ID:
Human(9191) Summary: This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21945) death effector domain-containing
Rat(83631) death effector domain-containing
chicken(425378) death effector domain containing
cow(538428) death effector domain containing
domestic cat(101091992) death effector domain containing
Horse(100066256) death effector domain containing
dog(488649) death effector domain containing
sheep(101106303) death effector domain containing
domestic guinea pig(100734796) death effector domain containing
naked mole-rat(101707280) death effector domain containing
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032998 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031141 MISSION® esiRNA esiRNA human DEDD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039711 Rosetta Predictions human pricing
NM_001039712 Rosetta Predictions human pricing
NM_032998 Rosetta Predictions human pricing
NM_031800 Rosetta Predictions rat pricing
NM_001128609 Rosetta Predictions mouse pricing
NM_011615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085323 predicted 338
2 SASI_Hs01_00085324 predicted 384
3 SASI_Hs01_00085325 predicted 553
4 SASI_Hs01_00085326 predicted 765
5 SASI_Hs01_00085327 predicted 529
6 SASI_Hs01_00085328 predicted 985
7 SASI_Hs01_00085330 predicted 543
8 SASI_Hs01_00085331 predicted 801
9 SASI_Hs01_00085332 predicted 862
10 SASI_Hs02_00308652 predicted 524
11 SASI_Hs01_00085329 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176990 predicted 310
2 SASI_Hs01_00176991 predicted 352
3 SASI_Hs01_00176992 predicted 526
4 SASI_Hs01_00176993 predicted 742
5 SASI_Hs01_00176994 predicted 500
6 SASI_Hs01_00176995 predicted 952
7 SASI_Hs01_00176997 predicted 520
8 SASI_Hs01_00176998 predicted 767
9 SASI_Hs01_00176999 predicted 832
10 SASI_Hs02_00308653 predicted 489
11 SASI_Hs01_00176996 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192925 predicted 368
2 SASI_Hs01_00192926 predicted 419
3 SASI_Hs01_00192927 predicted 588
4 SASI_Hs01_00192928 predicted 796
5 SASI_Hs01_00192929 predicted 560
6 SASI_Hs01_00192930 predicted 1014
7 SASI_Hs01_00192932 predicted 579
8 SASI_Hs01_00192933 predicted 825
9 SASI_Hs01_00192934 predicted 891
10 SASI_Hs02_00360645 predicted 549
11 SASI_Hs01_00192931 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265245 predicted 878
2 SASI_Rn01_00120914 predicted 392
3 SASI_Rn01_00120915 predicted 243
4 SASI_Rn01_00120916 predicted 832
5 SASI_Rn01_00120917 predicted 731
6 SASI_Rn01_00120918 predicted 809
7 SASI_Rn01_00120920 predicted 671
8 SASI_Rn02_00265246 predicted 677
9 SASI_Rn01_00120921 predicted 679
10 SASI_Rn02_00265247 predicted 663
11 SASI_Rn01_00120913 predicted 522
12 SASI_Rn01_00120919 predicted 337
13 SASI_Rn01_00120922 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310738 predicted 1781
2 SASI_Mm02_00310739 predicted 825
3 SASI_Mm02_00310740 predicted 1890
4 SASI_Mm02_00310741 predicted 1780
5 SASI_Mm02_00310742 predicted 663
6 SASI_Mm02_00310743 predicted 820
7 SASI_Mm02_00310744 predicted 1260
8 SASI_Mm02_00310745 predicted 1152
9 SASI_Mm02_00310746 predicted 1761
10 SASI_Mm02_00310747 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321047 predicted 1747
2 SASI_Mm02_00321048 predicted 800
3 SASI_Mm02_00321049 predicted 1856
4 SASI_Mm02_00321050 predicted 1743
5 SASI_Mm01_00086481 predicted 621
6 SASI_Mm01_00086482 predicted 793
7 SASI_Mm01_00086484 predicted 1228
8 SASI_Mm01_00086485 predicted 1124
9 SASI_Mm02_00321051 predicted 1731
10 SASI_Mm01_00086487 predicted 1041
11 SASI_Mm01_00086483 predicted 704
12 SASI_Mm01_00086486 predicted 852
13 SASI_Mm01_00086488 predicted 378
14 SASI_Mm01_00086489 predicted 557
15 SASI_Mm01_00086490 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011615
DEDD MISSION shRNA Bacterial Glycerol Stock
death effector domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011615.2-1325s1c1
Sequence:CCGGCAGCCTTTGTAAGGGATTGAACTCGAGTTCAATCCCTTACAAAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-879s1c1
Sequence:CCGGTCATTATTAGAGGCACTGAAACTCGAGTTTCAGTGCCTCTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-411s1c1
Sequence:CCGGCCTGATCTTGTAGACAAGTATCTCGAGATACTTGTCTACAAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-306s1c1
Sequence:CCGGCGCTGTGACGAGAGTAACTTTCTCGAGAAAGTTACTCTCGTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-374s1c1
Sequence:CCGGGCCCTACGTTACTCTCAAGAACTCGAGTTCTTGAGAGTAACGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011615
DEDD MISSION shRNA shRNA Plasmid DNA
death effector domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011615.2-1325s1c1
Sequence:CCGGCAGCCTTTGTAAGGGATTGAACTCGAGTTCAATCCCTTACAAAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-879s1c1
Sequence:CCGGTCATTATTAGAGGCACTGAAACTCGAGTTTCAGTGCCTCTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-411s1c1
Sequence:CCGGCCTGATCTTGTAGACAAGTATCTCGAGATACTTGTCTACAAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-306s1c1
Sequence:CCGGCGCTGTGACGAGAGTAACTTTCTCGAGAAAGTTACTCTCGTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-374s1c1
Sequence:CCGGGCCCTACGTTACTCTCAAGAACTCGAGTTCTTGAGAGTAACGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011615
DEDD MISSION shRNA Lentiviral Transduction Particles
death effector domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011615.2-1325s1c1
Sequence:CCGGCAGCCTTTGTAAGGGATTGAACTCGAGTTCAATCCCTTACAAAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-879s1c1
Sequence:CCGGTCATTATTAGAGGCACTGAAACTCGAGTTTCAGTGCCTCTAATAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-411s1c1
Sequence:CCGGCCTGATCTTGTAGACAAGTATCTCGAGATACTTGTCTACAAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-306s1c1
Sequence:CCGGCGCTGTGACGAGAGTAACTTTCTCGAGAAAGTTACTCTCGTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011615.2-374s1c1
Sequence:CCGGGCCCTACGTTACTCTCAAGAACTCGAGTTCTTGAGAGTAACGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032998
VALIDATED
DEDD MISSION shRNA Bacterial Glycerol Stock
death effector domain containing
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1003s1c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-935s1c1
Sequence:CCGGGCTCTTTATTAGAGGCACTTACTCGAGTAAGTGCCTCTAATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1345s1c1
Sequence:CCGGGAGCCGTAAGACAAATGTATACTCGAGTATACATTTGTCTTACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-867s1c1
Sequence:CCGGCATCATCTGTGACATCAAGTTCTCGAGAACTTGATGTCACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-493s1c1
Sequence:CCGGGAGGAGACATCAATTCGCTATCTCGAGATAGCGAATTGATGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1056s1c1
Sequence:CCGGGAAACTCCTGAGGAACTTGATCTCGAGATCAAGTTCCTCAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1558s1c1
Sequence:CCGGGCCACCCTCTTCCAAATTATACTCGAGTATAATTTGGAAGAGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1068s1c1
Sequence:CCGGGAACTTGATGCTGCAAGCATTCTCGAGAATGCTTGCAGCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1011s1c1
Sequence:CCGGGCTGCTGGTAAATGTAGACGACTCGAGTCGTCTACATTTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-404s21c1
Sequence:CCGGGAGCGTGGACTCATCCGAAATCTCGAGATTTCGGATGAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032998.2-1907s21c1
Sequence:CCGGGAGAAGAGGTTGCTGATTAAACTCGAGTTTAATCAGCAACCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-1100s21c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032998.2-584s21c1
Sequence:CCGGTATCTGGAGGAGACATCAATTCTCGAGAATTGATGTCTCCTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-904s21c1
Sequence:CCGGGCGCCAGTTTGAGCGCTTTAACTCGAGTTAAAGCGCTCAAACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032998
VALIDATED
DEDD MISSION shRNA shRNA Plasmid DNA
death effector domain containing
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1003s1c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-935s1c1
Sequence:CCGGGCTCTTTATTAGAGGCACTTACTCGAGTAAGTGCCTCTAATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1345s1c1
Sequence:CCGGGAGCCGTAAGACAAATGTATACTCGAGTATACATTTGTCTTACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-867s1c1
Sequence:CCGGCATCATCTGTGACATCAAGTTCTCGAGAACTTGATGTCACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-493s1c1
Sequence:CCGGGAGGAGACATCAATTCGCTATCTCGAGATAGCGAATTGATGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1056s1c1
Sequence:CCGGGAAACTCCTGAGGAACTTGATCTCGAGATCAAGTTCCTCAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1558s1c1
Sequence:CCGGGCCACCCTCTTCCAAATTATACTCGAGTATAATTTGGAAGAGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1068s1c1
Sequence:CCGGGAACTTGATGCTGCAAGCATTCTCGAGAATGCTTGCAGCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1011s1c1
Sequence:CCGGGCTGCTGGTAAATGTAGACGACTCGAGTCGTCTACATTTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-404s21c1
Sequence:CCGGGAGCGTGGACTCATCCGAAATCTCGAGATTTCGGATGAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032998.2-1907s21c1
Sequence:CCGGGAGAAGAGGTTGCTGATTAAACTCGAGTTTAATCAGCAACCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-1100s21c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032998.2-584s21c1
Sequence:CCGGTATCTGGAGGAGACATCAATTCTCGAGAATTGATGTCTCCTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-904s21c1
Sequence:CCGGGCGCCAGTTTGAGCGCTTTAACTCGAGTTAAAGCGCTCAAACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032998
VALIDATED
DEDD MISSION shRNA Lentiviral Transduction Particles
death effector domain containing
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1003s1c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-935s1c1
Sequence:CCGGGCTCTTTATTAGAGGCACTTACTCGAGTAAGTGCCTCTAATAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1345s1c1
Sequence:CCGGGAGCCGTAAGACAAATGTATACTCGAGTATACATTTGTCTTACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-867s1c1
Sequence:CCGGCATCATCTGTGACATCAAGTTCTCGAGAACTTGATGTCACAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-493s1c1
Sequence:CCGGGAGGAGACATCAATTCGCTATCTCGAGATAGCGAATTGATGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1056s1c1
Sequence:CCGGGAAACTCCTGAGGAACTTGATCTCGAGATCAAGTTCCTCAGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032998.1-1558s1c1
Sequence:CCGGGCCACCCTCTTCCAAATTATACTCGAGTATAATTTGGAAGAGGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1068s1c1
Sequence:CCGGGAACTTGATGCTGCAAGCATTCTCGAGAATGCTTGCAGCATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032998.1-1011s1c1
Sequence:CCGGGCTGCTGGTAAATGTAGACGACTCGAGTCGTCTACATTTACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-404s21c1
Sequence:CCGGGAGCGTGGACTCATCCGAAATCTCGAGATTTCGGATGAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032998.2-1907s21c1
Sequence:CCGGGAGAAGAGGTTGCTGATTAAACTCGAGTTTAATCAGCAACCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-1100s21c1
Sequence:CCGGGCCATCAAGCTGCTGGTAAATCTCGAGATTTACCAGCAGCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032998.2-584s21c1
Sequence:CCGGTATCTGGAGGAGACATCAATTCTCGAGAATTGATGTCTCCTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032998.2-904s21c1
Sequence:CCGGGCGCCAGTTTGAGCGCTTTAACTCGAGTTAAAGCGCTCAAACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks