EMAIL THIS PAGE TO A FRIEND

DEF6

differentially expressed in FDCP 6 homolog (mouse)

Synonyms: IBP SLAT SWAP70L
UniProtKB ID: Q9H4E7, Q86VF4
Gene ID:
Human(50619) Summary: DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]
Mouse(23853) differentially expressed in FDCP 6
Rat(309642) differentially expressed in FDCP 6 homolog (mouse)
chicken(419893) differentially expressed in FDCP 6 homolog (mouse)
domestic cat(101098142) differentially expressed in FDCP 6 homolog (mouse)
cow(516457) differentially expressed in FDCP 6 homolog (mouse)
Horse(100053351) differentially expressed in FDCP 6 homolog (mouse)
dog(608163) differentially expressed in FDCP 6 homolog (mouse)
sheep(101117371) differentially expressed in FDCP 6 homolog (mouse)
domestic guinea pig(100731763) differentially expressed in FDCP 6 homolog (mouse)
naked mole-rat(101722761) differentially expressed in FDCP 6 homolog (mouse)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022047 Rosetta Predictions human pricing
XM_001078315 Rosetta Predictions rat pricing
XM_228031 Rosetta Predictions rat pricing
NM_027185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043730 predicted 1939
2 SASI_Hs01_00043731 predicted 1687
3 SASI_Hs01_00043733 predicted 780
4 SASI_Hs01_00043734 predicted 585
5 SASI_Hs01_00043735 predicted 456
6 SASI_Hs01_00043736 predicted 1403
7 SASI_Hs01_00043737 predicted 1397
8 SASI_Hs01_00043738 predicted 1654
9 SASI_Hs02_00355399 predicted 452
10 SASI_Hs02_00355400 predicted 681
11 SASI_Hs01_00043732 predicted 225
12 SASI_Hs01_00043739 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360340 predicted 1846
2 SASI_Rn02_00360341 predicted 2106
3 SASI_Rn02_00360342 predicted 1374
4 SASI_Rn02_00360343 predicted 462
5 SASI_Rn02_00360344 predicted 1491
6 SASI_Rn02_00360345 predicted 2077
7 SASI_Rn02_00360346 predicted 710
8 SASI_Rn02_00360347 predicted 244
9 SASI_Rn02_00360348 predicted 2123
10 SASI_Rn02_00360349 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384841 predicted 1844
2 SASI_Rn02_00384842 predicted 2122
3 SASI_Rn02_00384843 predicted 2111
4 SASI_Rn02_00384844 predicted 2113
5 SASI_Rn02_00384845 predicted 1375
6 SASI_Rn02_00384846 predicted 2131
7 SASI_Rn02_00384847 predicted 1493
8 SASI_Rn02_00384848 predicted 2081
9 SASI_Rn02_00384849 predicted 2122
10 SASI_Rn02_00384850 predicted 1861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331720 predicted 253
2 SASI_Mm01_00176811 predicted 1827
3 SASI_Mm01_00176812 predicted 364
4 SASI_Mm01_00176813 predicted 365
5 SASI_Mm01_00176814 predicted 202
6 SASI_Mm01_00176815 predicted 210
7 SASI_Mm01_00176816 predicted 279
8 SASI_Mm01_00176817 predicted 416
9 SASI_Mm01_00176818 predicted 1927
10 SASI_Mm01_00176819 predicted 878
11 SASI_Mm01_00176810 predicted 1809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027185
DEF6 MISSION shRNA Bacterial Glycerol Stock
differentially expressed in FDCP 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027185.1-2052s1c1
Sequence:CCGGTGGAGGCTGTTTGAGATATTACTCGAGTAATATCTCAAACAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-221s1c1
Sequence:CCGGGCCCTACCTCAACAAGTACATCTCGAGATGTACTTGTTGAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1335s1c1
Sequence:CCGGGCTCTGCAACTAGAGGTGAAACTCGAGTTTCACCTCTAGTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1815s1c1
Sequence:CCGGAGCGAACAGAAGTCCCTCAATCTCGAGATTGAGGGACTTCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-426s1c1
Sequence:CCGGGTTCCCGATGAGGTAGAGTATCTCGAGATACTCTACCTCATCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027185
DEF6 MISSION shRNA shRNA Plasmid DNA
differentially expressed in FDCP 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027185.1-2052s1c1
Sequence:CCGGTGGAGGCTGTTTGAGATATTACTCGAGTAATATCTCAAACAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-221s1c1
Sequence:CCGGGCCCTACCTCAACAAGTACATCTCGAGATGTACTTGTTGAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1335s1c1
Sequence:CCGGGCTCTGCAACTAGAGGTGAAACTCGAGTTTCACCTCTAGTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1815s1c1
Sequence:CCGGAGCGAACAGAAGTCCCTCAATCTCGAGATTGAGGGACTTCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-426s1c1
Sequence:CCGGGTTCCCGATGAGGTAGAGTATCTCGAGATACTCTACCTCATCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027185
DEF6 MISSION shRNA Lentiviral Transduction Particles
differentially expressed in FDCP 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027185.1-2052s1c1
Sequence:CCGGTGGAGGCTGTTTGAGATATTACTCGAGTAATATCTCAAACAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-221s1c1
Sequence:CCGGGCCCTACCTCAACAAGTACATCTCGAGATGTACTTGTTGAGGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1335s1c1
Sequence:CCGGGCTCTGCAACTAGAGGTGAAACTCGAGTTTCACCTCTAGTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-1815s1c1
Sequence:CCGGAGCGAACAGAAGTCCCTCAATCTCGAGATTGAGGGACTTCTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027185.1-426s1c1
Sequence:CCGGGTTCCCGATGAGGTAGAGTATCTCGAGATACTCTACCTCATCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022047
DEF6 MISSION shRNA Bacterial Glycerol Stock
differentially expressed in FDCP 6 homolog (mouse)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-460s1c1
Sequence:CCGGGAGGTGGAATACCTGCTGAAACTCGAGTTTCAGCAGGTATTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-772s1c1
Sequence:CCGGCTCTGCTACTTTGGGAGTGAACTCGAGTTCACTCCCAAAGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-338s1c1
Sequence:CCGGAGAAGAACTATCGGGCAGATACTCGAGTATCTGCCCGATAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1833s1c1
Sequence:CCGGCAACAGCAATGAGCAGCAGAACTCGAGTTCTGCTGCTCATTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1388s1c1
Sequence:CCGGGAGATGAAGAATCTGTGCGAACTCGAGTTCGCACAGATTCTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022047
DEF6 MISSION shRNA shRNA Plasmid DNA
differentially expressed in FDCP 6 homolog (mouse)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-460s1c1
Sequence:CCGGGAGGTGGAATACCTGCTGAAACTCGAGTTTCAGCAGGTATTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-772s1c1
Sequence:CCGGCTCTGCTACTTTGGGAGTGAACTCGAGTTCACTCCCAAAGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-338s1c1
Sequence:CCGGAGAAGAACTATCGGGCAGATACTCGAGTATCTGCCCGATAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1833s1c1
Sequence:CCGGCAACAGCAATGAGCAGCAGAACTCGAGTTCTGCTGCTCATTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1388s1c1
Sequence:CCGGGAGATGAAGAATCTGTGCGAACTCGAGTTCGCACAGATTCTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022047
DEF6 MISSION shRNA Lentiviral Transduction Particles
differentially expressed in FDCP 6 homolog (mouse)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-460s1c1
Sequence:CCGGGAGGTGGAATACCTGCTGAAACTCGAGTTTCAGCAGGTATTCCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-772s1c1
Sequence:CCGGCTCTGCTACTTTGGGAGTGAACTCGAGTTCACTCCCAAAGTAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-338s1c1
Sequence:CCGGAGAAGAACTATCGGGCAGATACTCGAGTATCTGCCCGATAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1833s1c1
Sequence:CCGGCAACAGCAATGAGCAGCAGAACTCGAGTTCTGCTGCTCATTGCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022047.2-1388s1c1
Sequence:CCGGGAGATGAAGAATCTGTGCGAACTCGAGTTCGCACAGATTCTTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks