EMAIL THIS PAGE TO A FRIEND

DEF8

differentially expressed in FDCP 8 homolog (mouse)

64 Gene Product Result for
Gene ID:
Mouse(23854) differentially expressed in FDCP 8
Rat(307973) differentially expressed in FDCP 8 homolog (mouse)
Zebrafish(492523) differentially expressed in FDCP 8 homolog (mouse)
chicken(769452) differentially expressed in FDCP 8 homolog (mouse)
cow(513349) differentially expressed in FDCP 8 homolog (mouse)
Horse(100052770) differentially expressed in FDCP 8 homolog (mouse)
domestic cat(101082363) differentially expressed in FDCP 8 homolog (mouse)
dog(489651) differentially expressed in FDCP 8 homolog (mouse)
naked mole-rat(101725232) differentially expressed in FDCP 8 homolog (mouse)
domestic guinea pig(100733167) differentially expressed in FDCP 8 homolog (mouse)
sheep(101108245) differentially expressed in FDCP 8 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017702 Rosetta Predictions human pricing
NM_207514 Rosetta Predictions human pricing
NM_001024774 Rosetta Predictions rat pricing
NM_054046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023704 predicted 448
2 SASI_Hs01_00023705 predicted 445
3 SASI_Hs01_00023706 predicted 430
4 SASI_Hs01_00023707 predicted 469
5 SASI_Hs01_00023708 predicted 430
6 SASI_Hs01_00023709 predicted 425
7 SASI_Hs01_00023703 predicted 381
8 SASI_Hs01_00023710 predicted 197
9 SASI_Hs01_00023711 predicted 228
10 SASI_Hs02_00350460 predicted 343
11 SASI_Hs01_00023712 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130382 predicted 544
2 SASI_Hs01_00130383 predicted 537
3 SASI_Hs01_00130384 predicted 528
4 SASI_Hs01_00130385 predicted 558
5 SASI_Hs01_00130386 predicted 523
6 SASI_Hs01_00130387 predicted 524
7 SASI_Hs01_00130381 predicted 474
8 SASI_Hs01_00130388 predicted 1063
9 SASI_Hs01_00130389 predicted 1038
10 SASI_Hs01_00130390 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071538 predicted 1264
2 SASI_Rn01_00071540 predicted 1072
3 SASI_Rn01_00071541 predicted 466
4 SASI_Rn01_00071542 predicted 1437
5 SASI_Rn01_00071543 predicted 1018
6 SASI_Rn01_00071544 predicted 1383
7 SASI_Rn01_00071545 predicted 1422
8 SASI_Rn01_00071546 predicted 520
9 SASI_Rn01_00071547 predicted 1591
10 SASI_Rn02_00202664 predicted 1609
11 SASI_Rn01_00071539 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096644 predicted 1005
2 SASI_Mm01_00096645 predicted 1823
3 SASI_Mm01_00096646 predicted 511
4 SASI_Mm01_00096647 predicted 1894
5 SASI_Mm01_00096648 predicted 1184
6 SASI_Mm01_00096649 predicted 1777
7 SASI_Mm01_00096650 predicted 1870
8 SASI_Mm01_00096651 predicted 853
9 SASI_Mm01_00096652 predicted 642
10 SASI_Mm01_00096653 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207514
DEF8 MISSION shRNA Bacterial Glycerol Stock
differentially expressed in FDCP 8 homolog (mouse)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-650s1c1
Sequence:CCGGCAATGAGGATGAGCCAAACATCTCGAGATGTTTGGCTCATCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3381s1c1
Sequence:CCGGCCATTCCGAAATCTGTGTAATCTCGAGATTACACAGATTTCGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3380s1c1
Sequence:CCGGGCCATTCCGAAATCTGTGTAACTCGAGTTACACAGATTTCGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-860s1c1
Sequence:CCGGCCAAGCTGAATACGAACTGAACTCGAGTTCAGTTCGTATTCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-2553s1c1
Sequence:CCGGGCTCAGAAATGACCAGCCAATCTCGAGATTGGCTGGTCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-776s21c1
Sequence:CCGGCACCTGCACAGGGTGTTATTACTCGAGTAATAACACCCTGTGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-1294s21c1
Sequence:CCGGTTGTGGAGAACGACGAGATGTCTCGAGACATCTCGTCGTTCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207514
DEF8 MISSION shRNA shRNA Plasmid DNA
differentially expressed in FDCP 8 homolog (mouse)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-650s1c1
Sequence:CCGGCAATGAGGATGAGCCAAACATCTCGAGATGTTTGGCTCATCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3381s1c1
Sequence:CCGGCCATTCCGAAATCTGTGTAATCTCGAGATTACACAGATTTCGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3380s1c1
Sequence:CCGGGCCATTCCGAAATCTGTGTAACTCGAGTTACACAGATTTCGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-860s1c1
Sequence:CCGGCCAAGCTGAATACGAACTGAACTCGAGTTCAGTTCGTATTCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-2553s1c1
Sequence:CCGGGCTCAGAAATGACCAGCCAATCTCGAGATTGGCTGGTCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-776s21c1
Sequence:CCGGCACCTGCACAGGGTGTTATTACTCGAGTAATAACACCCTGTGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-1294s21c1
Sequence:CCGGTTGTGGAGAACGACGAGATGTCTCGAGACATCTCGTCGTTCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207514
DEF8 MISSION shRNA Lentiviral Transduction Particles
differentially expressed in FDCP 8 homolog (mouse)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-650s1c1
Sequence:CCGGCAATGAGGATGAGCCAAACATCTCGAGATGTTTGGCTCATCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3381s1c1
Sequence:CCGGCCATTCCGAAATCTGTGTAATCTCGAGATTACACAGATTTCGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-3380s1c1
Sequence:CCGGGCCATTCCGAAATCTGTGTAACTCGAGTTACACAGATTTCGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207514.1-860s1c1
Sequence:CCGGCCAAGCTGAATACGAACTGAACTCGAGTTCAGTTCGTATTCAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207514.1-2553s1c1
Sequence:CCGGGCTCAGAAATGACCAGCCAATCTCGAGATTGGCTGGTCATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-776s21c1
Sequence:CCGGCACCTGCACAGGGTGTTATTACTCGAGTAATAACACCCTGTGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207514.1-1294s21c1
Sequence:CCGGTTGTGGAGAACGACGAGATGTCTCGAGACATCTCGTCGTTCTCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054046
VALIDATED
DEF8 MISSION shRNA Bacterial Glycerol Stock
differentially expressed in FDCP 8 homolog (mouse)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-1019s1c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-512s1c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-510s1c1
Sequence:CCGGAGCGTTAAACAGACCTGCGATCTCGAGATCGCAGGTCTGTTTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-2954s1c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-335s1c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-334s21c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-1018s21c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054046.4-2952s21c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-511s21c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054046
VALIDATED
DEF8 MISSION shRNA shRNA Plasmid DNA
differentially expressed in FDCP 8 homolog (mouse)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-1019s1c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-512s1c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-510s1c1
Sequence:CCGGAGCGTTAAACAGACCTGCGATCTCGAGATCGCAGGTCTGTTTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-2954s1c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-335s1c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-334s21c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-1018s21c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054046.4-2952s21c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-511s21c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054046
VALIDATED
DEF8 MISSION shRNA Lentiviral Transduction Particles
differentially expressed in FDCP 8 homolog (mouse)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-1019s1c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-512s1c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-510s1c1
Sequence:CCGGAGCGTTAAACAGACCTGCGATCTCGAGATCGCAGGTCTGTTTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-2954s1c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054046.2-335s1c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-334s21c1
Sequence:CCGGCGAAGAATGCAAACAGGTGATCTCGAGATCACCTGTTTGCATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-1018s21c1
Sequence:CCGGGCCATACTTCATCACCTGCAACTCGAGTTGCAGGTGATGAAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054046.4-2952s21c1
Sequence:CCGGCGCTTCCTCTTTGGCGTTAAACTCGAGTTTAACGCCAAAGAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054046.4-511s21c1
Sequence:CCGGCGTTAAACAGACCTGCGATAACTCGAGTTATCGCAGGTCTGTTTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks